ID: 1146868142

View in Genome Browser
Species Human (GRCh38)
Location 17:36356321-36356343
Sequence TTAGGTTCACTCAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 5, 1: 0, 2: 3, 3: 7, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146868142 Original CRISPR TTAGGTTCACTCAGGGAAGT GGG (reversed) Intronic
900080710 1:855123-855145 TGAGGTTCACTGAGGTAAGTGGG + Intergenic
904715329 1:32463658-32463680 TTAGGGTCTCTCAGCGAAGGGGG + Intergenic
916561325 1:165936157-165936179 CCAGGGTCACTCAGAGAAGTGGG + Intergenic
917606470 1:176635919-176635941 TCAGGTTAACTCAGGGCATTTGG - Intronic
921157182 1:212447713-212447735 TGATGTGCACTCAGGGAACTGGG - Intergenic
922098724 1:222464639-222464661 TTTGGTACTTTCAGGGAAGTGGG - Intergenic
922274475 1:224064397-224064419 TCGGGTTCACCCAGGGAGGTGGG - Intergenic
1063154379 10:3365064-3365086 TTAGGAACACTGGGGGAAGTGGG + Intergenic
1065930542 10:30474862-30474884 TGAAGTTTACTCAGGGATGTAGG + Intergenic
1068801032 10:61139813-61139835 ATAGTGTCACTCAGGGAAGGAGG + Intergenic
1070359037 10:75669307-75669329 TGAGGTTCTCTGGGGGAAGTGGG + Intronic
1070791419 10:79191640-79191662 TTCCTCTCACTCAGGGAAGTTGG + Intronic
1072197753 10:93131112-93131134 TTAGCTTCTCTGAGGGAAATAGG - Intergenic
1073373985 10:103017054-103017076 TTAAGTTCTCTCAGTGGAGTAGG + Intronic
1073815002 10:107196820-107196842 TTATGTTATTTCAGGGAAGTTGG - Intergenic
1076479759 10:130777468-130777490 TAGGGTGCACTCAGGGAAGATGG - Intergenic
1079864515 11:25718354-25718376 TTAGGATCACTCTGGGTATTCGG + Intergenic
1085798325 11:79564212-79564234 TTAGTTTTACTCACGGAAGTGGG + Intergenic
1086179777 11:83936726-83936748 TTAGGCTCTCTCACGGCAGTGGG + Intronic
1089299482 11:117489977-117489999 TTAGGCTCACTCAGGGGAGCGGG + Intronic
1089743397 11:120600441-120600463 TGAGGCTAACTCAGGGAAATGGG + Intronic
1091615945 12:2051920-2051942 TTAGGGTCACCCAGGGAATGAGG + Intronic
1091624111 12:2109535-2109557 TGAGGTGAACTCAGAGAAGTGGG + Intronic
1092013371 12:5135844-5135866 TCAACTTCACTGAGGGAAGTGGG - Intergenic
1094743898 12:33320740-33320762 TTAGGTTGACCTGGGGAAGTGGG - Intergenic
1095363638 12:41374680-41374702 TGAGGTTTCCTTAGGGAAGTTGG + Intronic
1095726180 12:45455465-45455487 TTAGATCCACTCAGGGTAGAAGG - Intergenic
1096145905 12:49278503-49278525 TTAGTTTAACTCATGGAAGAGGG + Intergenic
1097608759 12:61789928-61789950 CTATGTTCACTCAGGGATATTGG - Intronic
1100285960 12:93166788-93166810 TTAGGTTCATGGAGGAAAGTGGG + Intergenic
1100614907 12:96223445-96223467 TTAGGTTCACTGGGGGAAGGAGG + Intronic
1102147089 12:110662138-110662160 TTAGGCTCCCTCAGGGACATTGG - Intronic
1105947504 13:25202380-25202402 ATAGGTTGACTGAGGGAAGATGG - Intergenic
1107216469 13:37926125-37926147 TTAGGAGGACTAAGGGAAGTTGG - Intergenic
1109756800 13:66771564-66771586 TGATGTTCATTCAGGGAAGATGG - Intronic
1119104757 14:71913455-71913477 TTAGGTTAACAGAGGAAAGTGGG + Intergenic
1119274259 14:73339447-73339469 TCAGGTTGCCTGAGGGAAGTAGG - Intronic
1122785217 14:104160389-104160411 TTATGTCCACACAGGGAAGCTGG + Intronic
1129483514 15:75845565-75845587 CTAAGTTTACTCAGGTAAGTTGG + Intronic
1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG + Intronic
1137648173 16:50094079-50094101 TGAGGGTCACCCAGGGGAGTTGG - Intronic
1137691867 16:50433981-50434003 CTAGAATCAATCAGGGAAGTGGG - Intergenic
1138246251 16:55469077-55469099 CTAAGGTCCCTCAGGGAAGTGGG + Intronic
1138542337 16:57695978-57696000 CTGGCTTCACCCAGGGAAGTGGG + Intronic
1141042496 16:80684216-80684238 TGAGCTGCCCTCAGGGAAGTGGG + Intronic
1144435263 17:15234220-15234242 GTGTGTTCACTCAGGCAAGTGGG + Intronic
1146852234 17:36232450-36232472 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1146868142 17:36356321-36356343 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1147071016 17:37956939-37956961 TTAGGTTCACTCAGGGAAGTGGG - Intergenic
1147082542 17:38036465-38036487 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1147098486 17:38160433-38160455 TTAGGTTCACTCAGGGAAGTGGG - Intergenic
1149242796 17:54670143-54670165 ATAGTTTCATTCAGGGAACTTGG - Intergenic
1149254409 17:54808431-54808453 TTAGATTAACTCATGGGAGTAGG + Intergenic
1149839173 17:59943229-59943251 TTAGGTTCAGTTAGGGAAGTGGG + Intronic
1150080025 17:62229459-62229481 TTAGGTTCAATTAGGGAAGTGGG - Intergenic
1150974232 17:70065932-70065954 TGAAGTTTACTCATGGAAGTGGG - Intronic
1151368988 17:73635580-73635602 TGAGGCTCATTCAGGGAATTTGG - Intronic
1151737074 17:75949854-75949876 TCAGGTGCACTCAGGAAAGTTGG - Exonic
1158024906 18:52885167-52885189 CTATGTTCACTCAAGGATGTAGG + Intronic
1158613380 18:58963361-58963383 TTCAGTTCACTCAGAGATGTAGG + Intronic
1159462055 18:68734209-68734231 TTAGCTTCCCTCAGGGAAGCAGG + Intronic
1160630082 18:80240861-80240883 GAAGGTTCAGTCAGGTAAGTGGG - Intronic
1160989832 19:1855973-1855995 TTGGGGCCACTCAGGGGAGTTGG - Intronic
1168356336 19:55702410-55702432 TTAGGCACACTAAGGGAAGCTGG - Intronic
925609194 2:5690656-5690678 TTAGGATGAGTCGGGGAAGTGGG + Intergenic
930666538 2:54104824-54104846 TTATGTTCACTTGGGGAACTTGG - Intronic
931908874 2:66872463-66872485 TTGAGTTCACCCAGGGAAATAGG - Intergenic
935567082 2:104620509-104620531 TTCAGTTTTCTCAGGGAAGTAGG - Intergenic
937889042 2:126921654-126921676 TTAGGTTCATTTAGGAAATTGGG - Intergenic
942042918 2:172082815-172082837 TTAGCTGCACTCAGTGAACTTGG - Intergenic
942801649 2:179882949-179882971 TTAGATACCATCAGGGAAGTGGG + Intergenic
945921378 2:215758194-215758216 TTCGGTTCACTTAGGGATATAGG + Intergenic
1168835819 20:876649-876671 TCAGGGTCACTCAGGGAAGTAGG + Intronic
1175808317 20:61843897-61843919 GGGGGTTCCCTCAGGGAAGTTGG - Intronic
1178578702 21:33817801-33817823 TTAGGTAGACCCAGGGAAATAGG - Intronic
1178584217 21:33859239-33859261 TCAGGATCACTCCGGGAAGCTGG + Intronic
1180982613 22:19885972-19885994 TGTGGATCACTCTGGGAAGTCGG + Intronic
952225613 3:31372621-31372643 TCAGGTTTGCTCAGGGAATTAGG - Intergenic
955574578 3:60346434-60346456 ATATGTGCACTGAGGGAAGTGGG + Intronic
962709190 3:138071412-138071434 CCAGGGTCACTCGGGGAAGTTGG - Intronic
965427128 3:168540865-168540887 TTAGGTTCAGTCTAGGAAATAGG - Intergenic
987722372 5:21654623-21654645 TCAGGTTCACTCAGATAAATGGG - Intergenic
992377574 5:76203556-76203578 TTAGTACCACTGAGGGAAGTGGG - Intronic
994890071 5:105622282-105622304 TGAGGTGCACTCAGGAGAGTCGG - Intergenic
1000186647 5:158865054-158865076 TTGGGTTGTCTCAGGGAAGGAGG - Intronic
1001852006 5:174975933-174975955 TTTGGTTCAAAGAGGGAAGTGGG + Intergenic
1003032074 6:2610258-2610280 TTAGGTTCACTCTTGGTATTTGG + Intergenic
1003840207 6:10112156-10112178 GTAGGTTGACTCAGGCAAGAAGG - Intronic
1004738626 6:18433794-18433816 TTAGTTTCACTCAGGTGAATGGG + Intronic
1012446312 6:99310493-99310515 TTAGAATCACCCAGGGAGGTGGG - Intronic
1016977885 6:149826835-149826857 CTAGGTTCACACAAGTAAGTGGG + Intronic
1018695816 6:166390663-166390685 TTAGCCTCACTAAGGGAAGGGGG + Intergenic
1026295621 7:69049420-69049442 TTAAATTCACTCAGGAAAATAGG + Intergenic
1028266487 7:88733020-88733042 TTATGTTCACTCAAGGTACTGGG + Intergenic
1030313030 7:108086919-108086941 TGAGGATCACTGAGGGAATTAGG + Intronic
1032253950 7:130282321-130282343 CTAGATTCACTGAGGGAAATTGG - Intronic
1034892181 7:154851066-154851088 TTAGGTTACTTCTGGGAAGTGGG + Intronic
1036236308 8:7042415-7042437 TTAGGGCCATTCAGGGAACTGGG + Intergenic
1036600392 8:10255448-10255470 TTAAATTCACTCAGGGAATCAGG - Intronic
1041561175 8:59219892-59219914 TTTAGGTCACTCAGGGAATTTGG + Intergenic
1044285536 8:90408440-90408462 TTTGTTTTACTGAGGGAAGTTGG + Intergenic
1044990529 8:97791505-97791527 TGAAGTTCACTCAGAGAAATTGG + Intronic
1048262229 8:132954877-132954899 TCTGCTTCACTCTGGGAAGTGGG + Intronic
1052013874 9:23443075-23443097 TTTGTTTCTCTCAGGGAAGAGGG - Intergenic
1053139619 9:35674434-35674456 CTCTGTTCACTCAGGGAAGGAGG + Intronic
1060399052 9:123336999-123337021 TTACAGTCACTCAGAGAAGTGGG + Intergenic
1061895029 9:133642681-133642703 TTTGGTCCAGGCAGGGAAGTGGG - Intronic
1185525074 X:772027-772049 TGAGGTTGACTCAGGGATCTGGG + Intergenic
1187865241 X:23717710-23717732 TAAGGAGCACTCAGGAAAGTGGG + Intronic
1189390503 X:40572462-40572484 TTAGGTTTTTTCAGGGGAGTTGG + Intergenic
1190033002 X:46992310-46992332 TTAGGCTCACACAGGGAAGCTGG - Intronic
1192924039 X:75736867-75736889 TTAGGTTTTCTCAGGGAGGGAGG + Intergenic
1197558946 X:127993089-127993111 TTATGTTCACTCAAGGATCTAGG - Intergenic
1199544241 X:148990562-148990584 CTTGGTTCACTTAGGGAAGGGGG - Intronic