ID: 1146871249

View in Genome Browser
Species Human (GRCh38)
Location 17:36379808-36379830
Sequence GATCCTCTGTTCTGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 14, 1: 5, 2: 2, 3: 15, 4: 255}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146871249_1146871257 18 Left 1146871249 17:36379808-36379830 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146871257 17:36379849-36379871 AGCTGCCCTCGGGCCAGTCGGGG 0: 14
1: 2
2: 2
3: 9
4: 119
1146871249_1146871260 30 Left 1146871249 17:36379808-36379830 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146871260 17:36379861-36379883 GCCAGTCGGGGTCTGACCCCAGG 0: 14
1: 0
2: 2
3: 25
4: 112
1146871249_1146871252 -6 Left 1146871249 17:36379808-36379830 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146871252 17:36379825-36379847 AGGATCATGAGGACAGTGTGAGG 0: 15
1: 6
2: 6
3: 63
4: 768
1146871249_1146871256 17 Left 1146871249 17:36379808-36379830 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146871256 17:36379848-36379870 AAGCTGCCCTCGGGCCAGTCGGG 0: 14
1: 6
2: 1
3: 6
4: 94
1146871249_1146871255 16 Left 1146871249 17:36379808-36379830 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146871255 17:36379847-36379869 GAAGCTGCCCTCGGGCCAGTCGG 0: 14
1: 4
2: 3
3: 12
4: 122
1146871249_1146871253 7 Left 1146871249 17:36379808-36379830 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146871253 17:36379838-36379860 CAGTGTGAGGAAGCTGCCCTCGG 0: 20
1: 0
2: 2
3: 47
4: 349
1146871249_1146871254 8 Left 1146871249 17:36379808-36379830 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146871254 17:36379839-36379861 AGTGTGAGGAAGCTGCCCTCGGG 0: 15
1: 7
2: 3
3: 24
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146871249 Original CRISPR GATCCTCTGTTCTGGCCCAG AGG (reversed) Intronic