ID: 1146872661

View in Genome Browser
Species Human (GRCh38)
Location 17:36386062-36386084
Sequence TGTAGCCCTAGGAGAACGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 3, 1: 0, 2: 2, 3: 10, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146872661_1146872675 21 Left 1146872661 17:36386062-36386084 CCCCCCGTTCTCCTAGGGCTACA 0: 3
1: 0
2: 2
3: 10
4: 100
Right 1146872675 17:36386106-36386128 TTTCCCCTCACGGGACAGTGAGG 0: 13
1: 0
2: 0
3: 8
4: 106
1146872661_1146872676 22 Left 1146872661 17:36386062-36386084 CCCCCCGTTCTCCTAGGGCTACA 0: 3
1: 0
2: 2
3: 10
4: 100
Right 1146872676 17:36386107-36386129 TTCCCCTCACGGGACAGTGAGGG 0: 13
1: 0
2: 0
3: 8
4: 116
1146872661_1146872671 11 Left 1146872661 17:36386062-36386084 CCCCCCGTTCTCCTAGGGCTACA 0: 3
1: 0
2: 2
3: 10
4: 100
Right 1146872671 17:36386096-36386118 CACCATGCCTTTTCCCCTCACGG 0: 13
1: 0
2: 0
3: 15
4: 208
1146872661_1146872672 12 Left 1146872661 17:36386062-36386084 CCCCCCGTTCTCCTAGGGCTACA 0: 3
1: 0
2: 2
3: 10
4: 100
Right 1146872672 17:36386097-36386119 ACCATGCCTTTTCCCCTCACGGG 0: 13
1: 0
2: 1
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146872661 Original CRISPR TGTAGCCCTAGGAGAACGGG GGG (reversed) Intronic