ID: 1146873045

View in Genome Browser
Species Human (GRCh38)
Location 17:36387777-36387799
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 12, 1: 2, 2: 10, 3: 50, 4: 437}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146873045_1146873056 12 Left 1146873045 17:36387777-36387799 CCACAGCTGCCCAAGGGCAGCAG 0: 12
1: 2
2: 10
3: 50
4: 437
Right 1146873056 17:36387812-36387834 AAGGGACCATGTGTGTTCAGTGG 0: 12
1: 3
2: 4
3: 24
4: 212
1146873045_1146873051 -6 Left 1146873045 17:36387777-36387799 CCACAGCTGCCCAAGGGCAGCAG 0: 12
1: 2
2: 10
3: 50
4: 437
Right 1146873051 17:36387794-36387816 CAGCAGGCTCCCCCGGACAAGGG 0: 12
1: 0
2: 0
3: 16
4: 116
1146873045_1146873058 14 Left 1146873045 17:36387777-36387799 CCACAGCTGCCCAAGGGCAGCAG 0: 12
1: 2
2: 10
3: 50
4: 437
Right 1146873058 17:36387814-36387836 GGGACCATGTGTGTTCAGTGGGG 0: 12
1: 1
2: 3
3: 20
4: 199
1146873045_1146873057 13 Left 1146873045 17:36387777-36387799 CCACAGCTGCCCAAGGGCAGCAG 0: 12
1: 2
2: 10
3: 50
4: 437
Right 1146873057 17:36387813-36387835 AGGGACCATGTGTGTTCAGTGGG 0: 13
1: 3
2: 3
3: 17
4: 171
1146873045_1146873050 -7 Left 1146873045 17:36387777-36387799 CCACAGCTGCCCAAGGGCAGCAG 0: 12
1: 2
2: 10
3: 50
4: 437
Right 1146873050 17:36387793-36387815 GCAGCAGGCTCCCCCGGACAAGG 0: 13
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146873045 Original CRISPR CTGCTGCCCTTGGGCAGCTG TGG (reversed) Intronic
900154712 1:1199274-1199296 CTGCTGCCCTTGGCCCCCAGAGG - Intergenic
900386804 1:2414367-2414389 CTGCTGTTCCTGGGCAGGTGGGG + Intergenic
900432221 1:2607761-2607783 CTGCTGGCCTGGGGAGGCTGTGG + Intronic
900562122 1:3312391-3312413 CTGCTGCCCTCGGGGCCCTGTGG - Intronic
900919194 1:5660012-5660034 CTGCTGGCACAGGGCAGCTGAGG + Intergenic
901207305 1:7504402-7504424 CTGCTTCCCTTTGGTATCTGAGG + Intronic
901468409 1:9438696-9438718 CAGCTGACCTGGGGGAGCTGGGG - Intergenic
902238641 1:15073944-15073966 CCCCTGCCCTTGGGCTCCTGAGG + Intronic
902583324 1:17423040-17423062 CTCCTTCCCTGGGGCAGCAGCGG + Intronic
902778581 1:18690384-18690406 CAGCAGCCCCTGGGGAGCTGCGG - Intronic
902884161 1:19393067-19393089 AAGCTGCCCTTGGGGAGTTGGGG - Intronic
902931808 1:19736664-19736686 CTCCTGGCCTTGGGTAGGTGAGG - Intronic
903012753 1:20342913-20342935 CTGCTTTCCTAGGACAGCTGCGG - Intronic
903173756 1:21568931-21568953 CTGCGGGCCTGGGGCAGCTGGGG + Intronic
904688141 1:32275154-32275176 CTGCGGCCCTTGACCAGCTCGGG + Intronic
904864038 1:33562407-33562429 CTGCAGCTCTTGGGTAGCAGAGG + Intronic
905545953 1:38800971-38800993 CAGCTGCGCTTGGGAAGGTGGGG - Intergenic
905877561 1:41442734-41442756 ATGCTGCCCTTGGCCAGCACTGG - Intergenic
906166398 1:43689621-43689643 CTCCTGCTCTGGGGCATCTGTGG + Intronic
906561130 1:46757777-46757799 CCCCTGCCCTTTGGCAGCTCAGG - Intergenic
906657534 1:47559446-47559468 GAGCTGCCCTTGGGCAGTGGGGG + Intergenic
906694518 1:47815082-47815104 CTGCTTCATTTGGGCAGCTCGGG + Intronic
907238505 1:53067531-53067553 CTGCTGCCCTGTGGTGGCTGTGG - Intronic
907788316 1:57635803-57635825 CTGGTGTCCTTGGCCAGGTGCGG + Intronic
907924586 1:58943890-58943912 CTTCTGCCCTTGGGCAGAGTGGG - Intergenic
908219580 1:61991544-61991566 CTGTTGCACCTGGCCAGCTGTGG - Intronic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
910101787 1:83585017-83585039 CTGCAACCCTTGGGAACCTGTGG + Intergenic
912491437 1:110064846-110064868 CAGCTGCCCTTGGACTGCCGAGG - Exonic
912906623 1:113714501-113714523 CTGCAGGCCTGGGGCAGCGGTGG + Intronic
913203595 1:116515929-116515951 CTCCTGCCCTCGCGCAGCTGGGG + Intronic
914199371 1:145471183-145471205 CTCCAGCACTTGGGAAGCTGAGG - Intergenic
914322979 1:146583186-146583208 CTGCTCCCCCTGGGCAGCCCTGG + Intergenic
914339406 1:146746213-146746235 CTGCTGTCCATGGGCAGGGGAGG - Intergenic
914478486 1:148044316-148044338 CTCCAGCACTTGGGAAGCTGAGG - Intergenic
914502371 1:148258475-148258497 CTCCAGCACTTGGGAAGCTGAGG + Intergenic
917969651 1:180198580-180198602 CTCCTGCTATGGGGCAGCTGGGG + Exonic
917972778 1:180219445-180219467 CTGCTCCCCCTCGGAAGCTGGGG - Intergenic
918852427 1:189709082-189709104 CTGCTGTCCTGGAGGAGCTGAGG - Intergenic
919924644 1:202186112-202186134 TCCCTGCCCTTAGGCAGCTGGGG + Intergenic
920687055 1:208117373-208117395 CTGCCACCATTGTGCAGCTGGGG - Intronic
921172304 1:212560310-212560332 CTTCTGCACTTGGGCAGATCTGG - Intergenic
921604282 1:217137113-217137135 CTGCTGGCATTGGGCAGAGGTGG - Intronic
921766814 1:218982674-218982696 CTGCTAGCCCTTGGCAGCTGTGG - Intergenic
922615980 1:226961464-226961486 CTGCAGCACTTGGGCATCGGAGG + Exonic
924709955 1:246523495-246523517 CTTCTGCCTTTGGGCAGTTGTGG - Intergenic
1063361439 10:5462791-5462813 CTGATCCCCTTTGCCAGCTGAGG + Intergenic
1064272903 10:13881076-13881098 CTTCTGCCATTTGCCAGCTGGGG + Intronic
1064312491 10:14223866-14223888 CTGCAACCCATGGGCACCTGTGG + Intronic
1064466282 10:15585443-15585465 CTGCTGTCCTGGTGCCGCTGGGG - Intronic
1065522488 10:26586189-26586211 CTGCTCTTCTTGGGCAGCTTGGG - Intergenic
1065528729 10:26647900-26647922 CTGCTCTTCTTGGGCAGCTTGGG - Intergenic
1065974182 10:30828162-30828184 ATGTCGCCCTTGGGCAGCAGAGG + Intronic
1066299543 10:34084715-34084737 CTGCTGGCCTGGGGGTGCTGTGG - Intergenic
1067159689 10:43814533-43814555 GTGCTCCCATTGTGCAGCTGTGG + Intergenic
1067752132 10:48978458-48978480 CTGCAGCCCTTGGGCTGAGGTGG - Intronic
1068121663 10:52786921-52786943 ATGCTGGCCTGGGGCAGGTGAGG - Intergenic
1068121676 10:52787008-52787030 ATGCTGGCCTGGGGCAGGTGAGG - Intergenic
1069886842 10:71629181-71629203 GTTCAGCCCTTGGGCAGCTAAGG + Intronic
1070461101 10:76671472-76671494 CAGCTCCCCTTGTGCAGCAGAGG + Intergenic
1070779743 10:79130541-79130563 CTCCTGCCCTCTGGGAGCTGGGG - Intronic
1071599966 10:86954251-86954273 GAGCTGCCCTTGGTCTGCTGTGG + Intronic
1071918980 10:90328124-90328146 CTGCTGCCATTGGAGGGCTGAGG - Intergenic
1072058021 10:91780090-91780112 CTGCAGCACTTTAGCAGCTGGGG - Intergenic
1072627472 10:97122382-97122404 CTGTTTCCCTTGGAGAGCTGGGG - Intronic
1076074384 10:127521788-127521810 AAGCTGGCCTTGGGCATCTGAGG - Intergenic
1076695373 10:132244706-132244728 CTGCTCCCCTCTGGCAGCGGAGG - Intronic
1076770980 10:132664654-132664676 CTGCTGCTGATGGGGAGCTGTGG - Intronic
1076868279 10:133180021-133180043 CTGCTGCCCTGGGGCCTCCGAGG + Intronic
1076877872 10:133225497-133225519 CAGCAGGCCTTGGGCACCTGGGG - Exonic
1077253261 11:1570057-1570079 CCGCTGGCCTGGGGAAGCTGTGG + Intronic
1078650257 11:13184685-13184707 CTGCTCTCCTTTGGCAGCCGAGG - Intergenic
1079105233 11:17567593-17567615 CTCCAGTCCTTTGGCAGCTGAGG - Intronic
1079391329 11:20024408-20024430 GAGCTGGCCTTGGGCTGCTGAGG + Intronic
1079391373 11:20024722-20024744 TGGCTGCCCTGGGGCAACTGTGG + Intronic
1080853014 11:36087825-36087847 CAGCTACTCTTGGGCAGCTGAGG - Intronic
1081786352 11:45750526-45750548 CTGCTGCCCCAGGGCAGATGTGG - Intergenic
1082975034 11:59062881-59062903 TTGCTGCCATTCTGCAGCTGCGG - Intergenic
1083144354 11:60747934-60747956 CTCCTGCCATTGGGAAGCTGTGG + Intergenic
1083720911 11:64603127-64603149 CTGCAGCCCCTGGGCCTCTGGGG + Intergenic
1083898127 11:65630459-65630481 ATGCTGCCTTTGGGCAGCGCTGG + Exonic
1084604210 11:70162867-70162889 CTGGGGACCTTGGGCAGCTGGGG - Intronic
1084944476 11:72631302-72631324 CTGCTTCCCATGGGCACCTCTGG + Intronic
1084993088 11:72947314-72947336 CTGCTCCTCTTGGCCAGATGTGG - Intronic
1085260986 11:75204593-75204615 CTGCTACTCTTGGCCAGGTGGGG - Exonic
1085526860 11:77169260-77169282 CTGCCTCCCTGGGGCAGCCGTGG + Intronic
1085574375 11:77589558-77589580 CTGCGGCCCTTGCGCCCCTGCGG - Intronic
1087036126 11:93758342-93758364 CAGCTGCGCCTGGGCAGTTGGGG - Intronic
1088068807 11:105755822-105755844 CTTCTGCCCTTGGACATCGGTGG + Intronic
1089010316 11:115126980-115127002 CTGCCTCCCTTGGGCAGCCTGGG - Intergenic
1089257688 11:117202471-117202493 CTGGTGCCTTTGTCCAGCTGCGG - Exonic
1089390311 11:118097498-118097520 CTTCTGCCCTGGGGGAGATGGGG - Intronic
1089777392 11:120847934-120847956 CTCCTGCCCTAGGGAAGCTCTGG - Intronic
1089923675 11:122234460-122234482 CTGATTCACTTGGCCAGCTGGGG - Intergenic
1090224884 11:125063753-125063775 TTTCTGTCGTTGGGCAGCTGGGG + Intronic
1090332369 11:125942047-125942069 CTGCTGCCCATGCACAGCGGAGG + Intergenic
1090567107 11:128006706-128006728 CTGCTGCCATTGGCTGGCTGGGG - Intergenic
1091793534 12:3284746-3284768 CTGCTGCACTTGATCAGGTGGGG + Exonic
1092520946 12:9272163-9272185 TTGGTGCACTTGGGCAGCTGAGG + Intergenic
1092947643 12:13471835-13471857 CATCTGCACTTGGGCAGCTTTGG + Intergenic
1093148714 12:15597377-15597399 CTGCTTCCCTGTGGCAACTGTGG + Exonic
1096284058 12:50283188-50283210 CTCCCGCCCTTGGGCAGCAAAGG + Intronic
1096700976 12:53382519-53382541 CTGCTGCACTTGGGCCCCAGTGG - Exonic
1097093066 12:56522784-56522806 GTGCTGTCCTTGGGCACATGGGG + Intronic
1097184933 12:57191464-57191486 ATGATGCCCATGGGCTGCTGGGG - Exonic
1097403061 12:59153178-59153200 CTGCTGACCTTGGGTCCCTGAGG + Intergenic
1098849416 12:75577631-75577653 CTGCAGGCCTTGGGAAGCTTAGG - Intergenic
1101746622 12:107546611-107546633 CTTCTGACCTTGGGAGGCTGAGG + Intronic
1101959032 12:109234195-109234217 CTGGCGACCTTGGGCAGATGTGG + Intronic
1102033611 12:109758781-109758803 CTGCTCCCCCTGGCGAGCTGGGG + Intronic
1102305334 12:111800298-111800320 CTCCTGCCCTGAGGCAGCTGGGG - Intronic
1103474557 12:121209343-121209365 CTCCTAAACTTGGGCAGCTGTGG - Intergenic
1104910341 12:132237224-132237246 CAGGTGGCCTGGGGCAGCTGAGG - Intronic
1107104352 13:36627198-36627220 CTGCTGCCCTTTGGCTTCTCTGG - Intergenic
1109105093 13:58240152-58240174 CTGCTGCGCTTAAGGAGCTGAGG - Intergenic
1110526284 13:76541946-76541968 ATGCTGCTCTTTGGCTGCTGTGG - Intergenic
1110799191 13:79675075-79675097 CTGATGCCTTTGTGCAGCTTTGG - Intergenic
1112206423 13:97328100-97328122 CTGCTGTTCTTGGGCACCTTGGG - Intronic
1113618841 13:111699540-111699562 CAGCTCCCCATGGGCAGCTGGGG + Intergenic
1113624370 13:111784801-111784823 CAGCTCCCCATGGGCAGCTGGGG + Intergenic
1113908508 13:113831176-113831198 GACCTGCACTTGGGCAGCTGTGG - Intronic
1114667947 14:24391712-24391734 CTGGTGTCCTTGGGCAGCCAAGG + Intergenic
1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG + Intergenic
1117813714 14:59576410-59576432 CTCCTGCCCTAGCGCAGCTGAGG - Intronic
1118793229 14:69115271-69115293 CTGCTGCCCTGAGGAAGCTTAGG + Intronic
1119168440 14:72514805-72514827 CCGCTGCCCTTGGGGAGGAGCGG + Intronic
1119289453 14:73483377-73483399 CTCCTGCACTCTGGCAGCTGGGG - Intronic
1119729538 14:76942216-76942238 CTGCTGTCCTTAGCCAGCAGAGG + Intergenic
1119852049 14:77873166-77873188 CTGCTGCCACTTGGCAGCAGAGG + Intronic
1120514030 14:85449116-85449138 GTGCTGCCCCTCTGCAGCTGAGG + Intergenic
1121485943 14:94314401-94314423 ATGCTGTCCCTGGGCACCTGTGG - Exonic
1122248351 14:100420189-100420211 CTGCGGCCCATGTGCAGATGGGG - Intronic
1122588143 14:102825483-102825505 CTTCAGCCCTGGGCCAGCTGTGG + Intronic
1122922964 14:104887502-104887524 CTGCTCCTCCCGGGCAGCTGGGG - Exonic
1122958789 14:105085105-105085127 ATGATGGGCTTGGGCAGCTGTGG - Intergenic
1123661861 15:22571677-22571699 GTCCTGGCCCTGGGCAGCTGGGG + Intergenic
1124262349 15:28203868-28203890 GTCCTGGCCCTGGGCAGCTGGGG - Intronic
1124315660 15:28665920-28665942 GTCCTGGCCCTGGGCAGCTGGGG + Intergenic
1125318138 15:38454297-38454319 CTACTTCCCTTGGGCCTCTGTGG + Intronic
1125767299 15:42144322-42144344 CTGCTGCCTATGGGCTGATGCGG - Intronic
1125832630 15:42727684-42727706 CTGCTGCCCGGGGGGAGCGGAGG - Exonic
1125932209 15:43608473-43608495 CTGAAGCCCTTGGGAGGCTGAGG + Intronic
1125945306 15:43707947-43707969 CTGAAGCCCTTGGGAGGCTGAGG + Intergenic
1127632829 15:60842298-60842320 CTGCAGCCCATGGGCAGCCAAGG - Intronic
1127895628 15:63296317-63296339 ATCCTGCCTCTGGGCAGCTGCGG + Intronic
1128089974 15:64912602-64912624 CAGCTGGCCTGGGGCAGCTTTGG + Intronic
1128380812 15:67110670-67110692 CTCCTGCCGTTGAGCAGCTATGG + Intronic
1128482865 15:68054685-68054707 CTGCCCCCCATGGGGAGCTGGGG + Intronic
1128787291 15:70407140-70407162 CCGCTGCCCTGGGACAGCTCTGG + Intergenic
1129717500 15:77860689-77860711 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1130233246 15:82112741-82112763 CTTTTCCCCTTGGGCAGCCGAGG + Intergenic
1130461252 15:84159508-84159530 CTGCTGCCCCTGGGCCACTCTGG - Intergenic
1130784887 15:87085088-87085110 CTACTGCCCTTGTGTACCTGGGG - Intergenic
1131533879 15:93217502-93217524 CTTTTGCCCTGGGCCAGCTGTGG + Intergenic
1132142841 15:99409277-99409299 CAGCTTCCCTCTGGCAGCTGGGG - Intergenic
1132473255 16:118841-118863 CGTCTGTCCTTGGGCAGGTGGGG - Intronic
1132613421 16:828834-828856 CTGCTGCTCCGGGGCCGCTGGGG + Intergenic
1132883817 16:2173694-2173716 CTGCTGCCCTGGGCCAGGGGTGG - Intronic
1133294793 16:4746415-4746437 CTCATGCCCTGGGCCAGCTGCGG - Exonic
1133778567 16:8918557-8918579 CTGAGCCCCTTGGGAAGCTGAGG + Intronic
1135158181 16:20072161-20072183 CTGCTCTCCTAGGGCAGCCGTGG + Intronic
1135582551 16:23641013-23641035 CTGCTGCCCTCGGACTGCCGAGG + Intronic
1135640637 16:24116865-24116887 TTTCTGTCCTGGGGCAGCTGGGG + Intronic
1136783142 16:32919676-32919698 CTGCAGTCCTTGGATAGCTGGGG + Intergenic
1136886645 16:33934173-33934195 CTGCAGTCCTTGGATAGCTGGGG - Intergenic
1137445783 16:48531362-48531384 CTTCTGCCCTTGTGCAGCTGTGG - Intergenic
1137716806 16:50603202-50603224 CTGCTGCCACTCGGCTGCTGAGG + Intronic
1138014410 16:53415699-53415721 ATGCTGAGCTTGGACAGCTGAGG + Intergenic
1138336366 16:56256528-56256550 CTGAGGCCTTTGGGCAGATGGGG - Intronic
1138433916 16:56986512-56986534 CTGCTGACCTTGGGCAGGATGGG + Intergenic
1138510991 16:57508328-57508350 CTGCTGCCCCTGGGCTGCTGTGG + Intergenic
1138514603 16:57529119-57529141 AGGCTGCCCTTGGACAGCTGCGG + Exonic
1139748387 16:69092945-69092967 CTCCTGCACTTTGGCAGCTTTGG + Intergenic
1139994869 16:70971134-70971156 CTGCTGTCCATGGGCAGGGGAGG + Intronic
1140010581 16:71127664-71127686 CTGCTACCCCTGGGCAGCCCTGG - Intronic
1140475705 16:75238407-75238429 CTGCTGCCCTGGGGGATGTGCGG - Intronic
1141386179 16:83624342-83624364 CTGCTGACCTGGGGCAGGGGTGG - Intronic
1141642833 16:85351274-85351296 CAGCAGCCCCTGGGCTGCTGTGG + Intergenic
1141999206 16:87654582-87654604 CTGCTTCCCGGTGGCAGCTGGGG + Intronic
1142046166 16:87926627-87926649 CTGCTTTCCTTGTGCTGCTGGGG - Intronic
1203085794 16_KI270728v1_random:1183661-1183683 CTGCAGTCCTTGGATAGCTGGGG + Intergenic
1143156872 17:4843045-4843067 CTCCTGGCCTTGGGTAGCTAAGG + Intronic
1143203757 17:5129458-5129480 CTTCTGCCCTTGGGCAGTTGTGG + Intronic
1143806435 17:9431583-9431605 CTGCTGCCCTTGGCCAGCCGCGG - Intronic
1144101070 17:11942836-11942858 TTGCTGCCTTTGAGGAGCTGAGG + Intronic
1144640345 17:16933383-16933405 CCTCTGCCCTCGGGCAGTTGTGG - Intronic
1144737815 17:17564700-17564722 CTGTCCCCCTTGGGCAGCTGTGG - Intronic
1144857957 17:18280738-18280760 ATGTTGTCCTCGGGCAGCTGAGG - Intronic
1144874939 17:18392569-18392591 CTTCTGCCCTTGGGCAGTTGTGG + Intergenic
1145157285 17:20551852-20551874 CTTCTGCCCTTGGGCAGTTGTGG - Intergenic
1145273960 17:21418998-21419020 CTGCCGCCTTTGGGGAGATGAGG - Exonic
1145759582 17:27418620-27418642 CTTCTGCCTTTGGGCAGTCGTGG + Intergenic
1145799456 17:27673717-27673739 CTTCTGCCTTTGGGCAGCTGTGG - Intergenic
1146159559 17:30552598-30552620 CTTCTGCCTTTGGGCAGCTGTGG + Intergenic
1146844828 17:36175932-36175954 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146857133 17:36263867-36263889 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146863482 17:36324508-36324530 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1146873045 17:36387777-36387799 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146880403 17:36438863-36438885 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146937595 17:36822016-36822038 CTGCTTTCCTTGCTCAGCTGGGG + Intergenic
1147066342 17:37925096-37925118 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147075928 17:37988402-37988424 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147077875 17:38004657-38004679 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147087453 17:38067948-38067970 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG + Intergenic
1147103397 17:38191911-38191933 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1147143402 17:38471857-38471879 CTGCAGTCCTTGGATAGCTGGGG + Exonic
1147534632 17:41311617-41311639 CAGCTGCACTTGGGAGGCTGAGG + Intergenic
1147923599 17:43933334-43933356 ATGCTTCCCAAGGGCAGCTGGGG - Intergenic
1148077914 17:44949935-44949957 CTGCTTCCTTTGAGCACCTGGGG - Intergenic
1148227516 17:45909228-45909250 CTGTTGCCATTGGGCAGCCCAGG - Intronic
1148497505 17:48061851-48061873 CTGCACCCCTTTGGCAGGTGAGG - Intergenic
1148871426 17:50660733-50660755 CAGATGCCCTCTGGCAGCTGAGG + Intronic
1149847971 17:60018380-60018402 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1150086326 17:62274997-62275019 CTGCTGCCCTTGGGCAGCCGTGG - Intronic
1151653759 17:75485958-75485980 CTGCTGCTGCTGGGCTGCTGCGG + Exonic
1151694521 17:75707366-75707388 GTGCTGCCCAGGGGCTGCTGTGG - Exonic
1151745858 17:76011434-76011456 CTGCAGCCCCTGGGCAGCTCTGG - Intronic
1151786635 17:76278423-76278445 CTGCTGCCTGTCTGCAGCTGTGG + Intronic
1152294359 17:79457981-79458003 CTGCTGCCCTGGCCCAGGTGAGG - Intronic
1152556925 17:81058003-81058025 CTGATGCCCTCAGGCAGCTCTGG + Intronic
1152626768 17:81391272-81391294 CTGCTGCTCTTGGGGAGCGTGGG + Intergenic
1152630327 17:81408091-81408113 CTGCTGCCCCTGTGTGGCTGTGG + Intronic
1152811975 17:82386525-82386547 CGCCTTCCCCTGGGCAGCTGGGG + Intergenic
1153319084 18:3753870-3753892 CTGTTGTCCTTGGGAATCTGTGG + Intronic
1155429222 18:25738111-25738133 CAGCTGTCCCTGGGCAGATGAGG + Intergenic
1156699998 18:39814753-39814775 CTTCTGCCCCTGGTCAGCTTGGG + Intergenic
1156979355 18:43266006-43266028 CTGCTTCCCTTGGGTAGGGGAGG + Intergenic
1157585213 18:48796672-48796694 CTTCTGCCCTTGGGTGGCTGTGG - Intronic
1157824568 18:50801130-50801152 GTGCTGGGCTTGGGCAGGTGGGG + Intronic
1158400436 18:57116795-57116817 CTGCTGCCCTATGGGGGCTGTGG - Intergenic
1160800686 19:966701-966723 CAGCTGCCCTGGAACAGCTGCGG + Exonic
1161043125 19:2120629-2120651 CCTCTGCCCTCGGGCATCTGTGG - Intronic
1161051881 19:2168409-2168431 CTTCTGCCCTGGGGGACCTGTGG + Intronic
1161219281 19:3110607-3110629 CTGAGGCCCTGGGGAAGCTGAGG + Intronic
1161298515 19:3531857-3531879 CTCCTGCCCTCGCGGAGCTGGGG - Intronic
1161628172 19:5338896-5338918 CTGCTGTCCTTGGGGTGCAGAGG - Intronic
1161664384 19:5565951-5565973 CTGCCGGCCTGGGGCAGCTCTGG - Intergenic
1162478650 19:10915548-10915570 CTTCTGCCCTGGGGGACCTGGGG - Intronic
1162524196 19:11197812-11197834 CTGCTGTCCCTGGGCCGCTGCGG + Intergenic
1162573603 19:11486247-11486269 AAGCTGCCCTTGGCCAGGTGCGG - Intronic
1162829660 19:13276390-13276412 CAGGTGCCCTTTGGCATCTGTGG - Intronic
1163421909 19:17218400-17218422 CTGCGGCCCTGGGGCAGTAGTGG + Intronic
1163752750 19:19087875-19087897 CTGTTGGCCTGGGGAAGCTGGGG + Intronic
1163786672 19:19278330-19278352 CTGCTGCTGTTGGGCTCCTGAGG - Intronic
1163860440 19:19740023-19740045 CCTCTGTCCTTGGGCAGTTGTGG + Intergenic
1164669278 19:30063571-30063593 CTGATGGCCTTGGGCAGGTTGGG - Intergenic
1164690645 19:30208517-30208539 CTGCTGGCCCCGGGGAGCTGGGG + Intergenic
1164707157 19:30328317-30328339 AAGTTGCCCTTGGGTAGCTGTGG - Intronic
1165429110 19:35762124-35762146 CTGCTGCACTTTGACTGCTGGGG - Exonic
1166204439 19:41259870-41259892 CTCCTGCCCTGGGGCTGCTGGGG - Exonic
1166293468 19:41877841-41877863 CAGCTGTCCTTGAGCAGGTGAGG - Intronic
1166863513 19:45822922-45822944 CTGCTCGCCCTGGGGAGCTGAGG + Intronic
1167292201 19:48630494-48630516 CTGCAGCCCGTGGGCAGCTCCGG - Exonic
1167432971 19:49463980-49464002 CTGCTGCCCTTGGCTGGCGGTGG - Intronic
1167507659 19:49879386-49879408 CTCCTGCCCTGGGGCAGCGCAGG - Intronic
925193209 2:1902336-1902358 CTGCTGGCTTGTGGCAGCTGTGG - Intronic
926384020 2:12318084-12318106 CTGCTCCCCTTGTACACCTGAGG + Intergenic
926982604 2:18587083-18587105 ACGCTGCCTTTGTGCAGCTGAGG - Exonic
928040682 2:27873307-27873329 CTGCTATTCTTGGGCAACTGTGG + Intronic
930004149 2:46882603-46882625 TTGCTGCCAATGAGCAGCTGAGG - Intergenic
930619410 2:53628068-53628090 CTGTTGCCCGTGGGCTCCTGGGG - Intronic
930758926 2:55010246-55010268 CTGCTGCAGTTGTGCAGCAGAGG - Intronic
930906627 2:56576341-56576363 CTGCTGGCCTTGGGATCCTGTGG + Intergenic
931219819 2:60278764-60278786 GTTCTGGCCTTGGGCAGCAGGGG + Intergenic
931231166 2:60376052-60376074 CTTCTTCCCTTGGGGAGCTCTGG + Intergenic
931253502 2:60552411-60552433 CTCCTGCCCTTCGGCGGCGGCGG + Intronic
931628781 2:64281077-64281099 GAGCTGCACTTGTGCAGCTGTGG - Intergenic
932335494 2:70928732-70928754 CTCCAGTCCTTGGGAAGCTGAGG - Intronic
932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG + Intronic
934712414 2:96524799-96524821 CTGCTGCCCTCGGGCAGTTAGGG - Intergenic
934957769 2:98638002-98638024 ATGCTCCCCTTGGGCAAGTGGGG + Intronic
934968386 2:98743049-98743071 ATGCTGCCCTTTGGCAGGAGTGG + Intergenic
935581113 2:104756498-104756520 CAGTTGGCCTTGGGAAGCTGGGG - Intergenic
935695074 2:105764213-105764235 CTGCTGGCCTTCAGCACCTGTGG + Intronic
936492396 2:112983531-112983553 CAGCTGGCCTTGGGAAGATGTGG + Intronic
936754480 2:115689896-115689918 CTGCTGCCCTTGGACACCCCAGG - Exonic
936870324 2:117128918-117128940 CTGCTGCTCTTGTGAAGGTGAGG - Intergenic
936874402 2:117171484-117171506 CTGCTGCCCTAGGGAATCTGCGG + Intergenic
938063473 2:128269185-128269207 CTGCTGGCCTCAGGCGGCTGTGG - Intronic
938291792 2:130154536-130154558 CTGCTGCCCTTAGGATTCTGGGG + Intronic
938369887 2:130762383-130762405 CAGCTGCCCTGTGGCAGCCGTGG - Exonic
938464757 2:131518428-131518450 CTGCTGCCCTTAGGATTCTGGGG - Intergenic
939600732 2:144186907-144186929 CTGCTGTCATTTTGCAGCTGAGG - Intronic
939861317 2:147423868-147423890 TTGCTGCCCTTGTTCAGGTGTGG - Intergenic
940015489 2:149100092-149100114 ATGCTGGCCAGGGGCAGCTGGGG + Intronic
940182093 2:150946058-150946080 CTGCTTCTCTTGGGCAGTGGAGG - Intergenic
941860445 2:170273406-170273428 CTTCATCCTTTGGGCAGCTGTGG - Intronic
944256035 2:197624672-197624694 CTACTGCGCCTGGCCAGCTGTGG - Intronic
945270812 2:207937985-207938007 CTACTGCCCTTGTGGAGCTGAGG - Intronic
945943261 2:215970583-215970605 CTGCTGCCCTTGTGCATGTATGG - Intronic
946295105 2:218777789-218777811 CTGCTGCCCTTGGGCAACATGGG + Intergenic
948313849 2:237011633-237011655 CTGCAGTCCTGAGGCAGCTGAGG + Intergenic
948333754 2:237192114-237192136 ATGCTGAGCTTGGACAGCTGAGG - Intergenic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
948859073 2:240744179-240744201 CTGCTGCCCCTGGGCAGACGTGG - Intronic
1169210065 20:3760805-3760827 AGGCTGCCGTTGGGGAGCTGAGG - Intronic
1169745114 20:8935597-8935619 CTACTGCCCCTGAGCAGATGCGG + Intronic
1170530716 20:17288242-17288264 CTGCTACCCTAGGGCACATGAGG + Intronic
1170674430 20:18466657-18466679 CAGCTGCCCTTAGGAAGCTGGGG + Intronic
1170713230 20:18810511-18810533 CTCCTGCCTTTGGACATCTGGGG + Intronic
1170889947 20:20368355-20368377 CTGCTGCTCTCGCCCAGCTGCGG + Exonic
1171144113 20:22766789-22766811 CTGCTTCCATTGGGAAGCTCCGG - Intergenic
1172093981 20:32451791-32451813 CTGCTGGCCTGGCCCAGCTGTGG - Intronic
1172823355 20:37758592-37758614 CTTCTGCCGCTGGCCAGCTGGGG - Intronic
1173255484 20:41391900-41391922 CTGCAGCCCTTGGGCAGATGTGG + Intergenic
1173643794 20:44621362-44621384 CTGCTGCCTTTGCCCAGCTCTGG - Intronic
1173654492 20:44690240-44690262 CTTCTCCCCTTGCCCAGCTGGGG - Intergenic
1173823188 20:46031523-46031545 TTGCTGACCTCGGGCAGGTGGGG + Intronic
1175335077 20:58190424-58190446 TTGCTGCCCGTGGACACCTGTGG - Intergenic
1175808022 20:61841509-61841531 CTGGTGGCCTTGGGCAGTAGAGG + Intronic
1175814871 20:61878092-61878114 CTGTAGGCCTGGGGCAGCTGGGG + Intronic
1176067894 20:63208779-63208801 CTGCTGTGCCTGGGCAGCTCTGG - Intronic
1176240794 20:64074986-64075008 CTGCTCCCCTGGGGGAGATGGGG + Intronic
1176241225 20:64076811-64076833 CTGCTCCCCTGGGGGAGATGGGG - Intronic
1176272886 20:64245570-64245592 CTCCTGCCCCTGGGCTCCTGTGG - Intergenic
1176312723 21:5161848-5161870 CTGCTGACCTCGCGCTGCTGGGG + Intergenic
1177655457 21:24011136-24011158 CAGCTGCCCTTACACAGCTGAGG - Intergenic
1179710794 21:43211889-43211911 CAGCTGGCCTTGGGGAGCTGGGG + Intergenic
1179718705 21:43303348-43303370 CTCGTGTCCTTGGGCAGCTCCGG - Intergenic
1179818665 21:43923775-43923797 CTTCTGTCCCTGGGGAGCTGGGG + Intronic
1179844325 21:44100182-44100204 CTGCTGACCTCGCGCTGCTGGGG - Intronic
1180009955 21:45042952-45042974 AGGCTGCCCTTGGGCAGCCTCGG - Intergenic
1180154328 21:45970809-45970831 CTGGTGCCCATGGGCAGCAGAGG + Intergenic
1180229931 21:46421220-46421242 CTGCAGCACTTGGGCACCTGGGG - Intronic
1180252318 21:46597623-46597645 CTGCTGCCGGGGGGCAGCTCTGG - Intergenic
1181491352 22:23262643-23262665 CAGCTGCTCTTGGGCAGCCAGGG + Intronic
1181646643 22:24234878-24234900 TTGCTGCCCATGGACAGATGGGG - Intronic
1182500053 22:30740133-30740155 CTGCTCCCCTTGGCCAGGCGCGG - Intronic
1182942405 22:34289305-34289327 ATGCTGCCCCTGTGCAACTGTGG - Intergenic
1183130600 22:35831315-35831337 CACCTGCCCTTGGGAGGCTGAGG + Intronic
1183269753 22:36853692-36853714 CCGCTGCCCTTGGCCAGGAGGGG - Intergenic
1183582568 22:38734666-38734688 CAGCTGCTCTTGGGCAGATGAGG - Intronic
1183740921 22:39668187-39668209 CTTCTGCCCTTGGGAGGCAGAGG - Intronic
1184188255 22:42878662-42878684 CTGGTTCCCTCAGGCAGCTGAGG - Intronic
1184288226 22:43483910-43483932 CTGCTGCCCGTGGCCAGTGGGGG + Intronic
1184403541 22:44287281-44287303 CTGCTTCCCTTGGGCTCCTCTGG + Intronic
1184479738 22:44739304-44739326 CTCCTGCCCTGGGGCAGGAGGGG + Intronic
1184749949 22:46479531-46479553 CTCCTGCCCAGAGGCAGCTGTGG - Intronic
1184767070 22:46577497-46577519 CTGCTCCCCGCGGGCACCTGCGG + Intronic
949206339 3:1443107-1443129 CTGCAGCTCTGGGGCAGCAGCGG - Intergenic
949894867 3:8761488-8761510 CTGCTGGCCTGGGGCGGCAGGGG + Intronic
950123479 3:10497050-10497072 CTGCTGACCTTGGGCAGCTGTGG + Intronic
950990005 3:17424325-17424347 CAGCTGCCCTTGGGAAGAGGAGG + Intronic
952543647 3:34395664-34395686 CTGCTGCCAGTGGGGAGATGTGG + Intergenic
953295319 3:41710005-41710027 CTGCTTCCTTTGGGAACCTGAGG + Intronic
954613852 3:51959704-51959726 CTGAGGCCACTGGGCAGCTGGGG - Intronic
954615630 3:51967576-51967598 CTGCGGCACTGGGGCGGCTGGGG - Intronic
954878028 3:53815911-53815933 CTGCTGCTGTGGGGCAGGTGGGG + Exonic
954914726 3:54139045-54139067 CTGCTGAGCTTGGGGATCTGGGG + Intronic
955361636 3:58281218-58281240 CTGCTGGCCTTGCTGAGCTGTGG + Intronic
955499432 3:59569634-59569656 CTACTGCCCTTGGTTACCTGTGG - Intergenic
959629254 3:108489974-108489996 CTGATGCCTTTGGGCTGCTATGG - Intronic
961052826 3:123761602-123761624 ATGATGCCTTTGGGCAGCTTGGG - Intronic
961450331 3:126999648-126999670 CTGCTGCCGGCGGGCAGCTGAGG - Intronic
961513734 3:127420157-127420179 CTGCAGCCCATGGGCAGGAGGGG + Intergenic
961790267 3:129371065-129371087 CTGGTGTCCCTGGGCAGCTTCGG + Intergenic
962288361 3:134107326-134107348 CAGGTGCCCATGGGCAGTTGGGG - Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
962449887 3:135504158-135504180 GGGGTGCCCTTGAGCAGCTGGGG + Intergenic
963016290 3:140827500-140827522 CTGCTGCAATTGTGCAACTGGGG - Intergenic
965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG + Intronic
966590337 3:181675092-181675114 CTGCTGCCTCTGGGAATCTGAGG - Intergenic
967194065 3:187011534-187011556 TTGTTGTCCTTGGGAAGCTGAGG + Intronic
968135708 3:196218019-196218041 CTGGTGCACCTGGGCAGCCGGGG + Intronic
968473144 4:791153-791175 CTGAAGCCCTGGGTCAGCTGCGG + Intronic
968731791 4:2272646-2272668 CTGCTGCCCATGAGCTGCTGAGG - Intronic
968871465 4:3244861-3244883 CTGCTCCTCTTGGGCACGTGCGG + Intronic
969429374 4:7145266-7145288 CAGCTGCCCAGGGGCAGCAGGGG - Intergenic
969443087 4:7228740-7228762 CAGCTGCTCTGGGGCTGCTGTGG + Intronic
969706271 4:8793988-8794010 CTGCTGCCCCAGGGTGGCTGGGG - Intergenic
969724607 4:8911793-8911815 CAGCTGCCCACGGGCACCTGTGG - Intergenic
973045882 4:45534123-45534145 CTGCTTCCCTTGAGCGGCTACGG + Intergenic
977415083 4:96722275-96722297 CTGCTTCCCTTGGCCAGGGGTGG + Intergenic
978105055 4:104892343-104892365 TTGCTGCCCCTGAGCTGCTGTGG - Intergenic
978409959 4:108415895-108415917 CTGCTGGCCTGGGGCAACTTTGG + Intergenic
980387171 4:132101358-132101380 CTGCTGTACTTGGGGAGCTGAGG - Intergenic
981527504 4:145720878-145720900 TTGCAAACCTTGGGCAGCTGTGG - Intronic
982200212 4:152953016-152953038 CAGCTGCCCTCGGGAGGCTGAGG + Intronic
983454459 4:167945420-167945442 CTCCTGCCCTTGGACAAGTGTGG - Intergenic
983547607 4:168979572-168979594 CTGCAGCCCAAGGGCAGCTAGGG - Intronic
985126662 4:186701566-186701588 CTGATGCCCTGTGGGAGCTGGGG - Intronic
985481070 5:111282-111304 CAGCTTCCCTGGGGCAGCTCTGG + Intergenic
985536837 5:469681-469703 CTGCGGCCCATGGGCAGCCATGG - Intronic
985560414 5:583306-583328 CTGGTGCCCTTGGACACCTGTGG + Intergenic
986299309 5:6465963-6465985 CTGGGGCCCCTGGGCAGCAGAGG - Intronic
986773842 5:10996154-10996176 CAGCTGCCCTAGGGCAGGTGTGG + Intronic
987247658 5:16064687-16064709 CAGTTGCCCTAGGGCAGCTGGGG - Intergenic
987530676 5:19115160-19115182 CTTCTGCCCCTGGTCAGCTTAGG - Intergenic
988829906 5:34977338-34977360 CTTCTGCCCCTGTGGAGCTGGGG + Intergenic
989099200 5:37808711-37808733 CTGCTGACCCTGGGGAGCAGGGG - Intergenic
989111169 5:37907763-37907785 CTGCTGCCCTTGAGAAAATGTGG - Intergenic
989178792 5:38556415-38556437 CTCCTGCCCCCGGGCGGCTGTGG - Intronic
989993860 5:50803154-50803176 CTGCTGCCTTTGGGTATTTGTGG + Intronic
991670055 5:69038330-69038352 CTGCTGCCCTAGGGAGTCTGAGG - Intergenic
992455216 5:76910173-76910195 CTGCTATCCTTGAGCAGCTATGG + Intronic
995784246 5:115811791-115811813 CTCCTTCCTTTGGGGAGCTGTGG + Intronic
996789142 5:127273269-127273291 CTGCTTCCCTTGGCCAGGGGTGG + Intergenic
997688967 5:135812788-135812810 CTGGTGTACATGGGCAGCTGGGG - Intergenic
997734142 5:136201079-136201101 CAGCTCCCATTGGGGAGCTGTGG - Intergenic
998007374 5:138665951-138665973 CTGTTGCCCTGTGGGAGCTGTGG + Intronic
998146453 5:139731785-139731807 CTGCTGTCCCTGGGTACCTGGGG - Intergenic
998159402 5:139804631-139804653 TTGCTTCCCTGGGTCAGCTGTGG + Intronic
1001398539 5:171433316-171433338 CAGCTCCCCTTGGGGACCTGGGG + Intronic
1001816903 5:174676960-174676982 ATGCTGCCATTGGCCGGCTGTGG - Intergenic
1001851373 5:174969825-174969847 CTGCTGCACTAGAGGAGCTGTGG + Intergenic
1002159469 5:177306756-177306778 ATTCTCCCATTGGGCAGCTGAGG + Exonic
1002199727 5:177520968-177520990 GAGCTGCCCCTGGGGAGCTGAGG + Intronic
1002699999 5:181116997-181117019 CTTCTGCTCTTGGCCAGGTGTGG + Intergenic
1002700609 5:181121897-181121919 ACGCTGCCCTTTGGCAGCCGTGG - Intergenic
1002844623 6:935734-935756 GGGCTGCCCTGGGGCTGCTGGGG - Intergenic
1003176591 6:3756775-3756797 CTGCAGCTCTTGGCCAGGTGTGG + Intergenic
1003952272 6:11127390-11127412 CTGTGGGCCTAGGGCAGCTGTGG - Intronic
1004320762 6:14629916-14629938 CTGGTGCCCTTGTGCTTCTGTGG - Intergenic
1005807777 6:29491106-29491128 CTGCTCACCTTGGGCAGGTGTGG + Intergenic
1006339934 6:33441360-33441382 CTGCTGACCTTGCTGAGCTGGGG - Exonic
1006576867 6:35053000-35053022 CATCTCTCCTTGGGCAGCTGGGG - Intronic
1006676624 6:35769225-35769247 CTGCTGCCATCAGGCAGGTGAGG - Intergenic
1006741685 6:36313362-36313384 CTGAGGCCTGTGGGCAGCTGGGG - Intergenic
1007164846 6:39821975-39821997 CAGCTGCCCATGAGCAGCAGCGG + Intronic
1007318526 6:41009447-41009469 CTTCTCCCCTTGGGCATCTCGGG - Intergenic
1007605358 6:43114030-43114052 CTGCGGCCCCAGGGCTGCTGGGG + Intronic
1007631182 6:43274571-43274593 CTGCTGTCCTTGGGTTGATGTGG + Intronic
1007699743 6:43759632-43759654 CTGCTGCCCCTGGGGAGGTCTGG + Intergenic
1008663913 6:53697162-53697184 ATGAGGCCCCTGGGCAGCTGCGG + Intergenic
1015023771 6:128508613-128508635 CAGTTGCCCTTGGCCAACTGTGG + Intronic
1017002341 6:150005148-150005170 CCGCTGCCATTGGGGACCTGGGG + Intergenic
1017114981 6:150967770-150967792 CTGCTGCACTCGTGCAGGTGGGG - Intronic
1019014231 6:168867943-168867965 CTGCAGGCCTTTGGCTGCTGCGG + Intergenic
1019427914 7:986054-986076 CTGCTGCCCTGGGGCTGCCCCGG - Intronic
1019564773 7:1673873-1673895 GAGCTGTCCTGGGGCAGCTGGGG + Intergenic
1019760870 7:2811692-2811714 CAGCAGCCCTTGGGCAGCATTGG - Intronic
1020274878 7:6617789-6617811 CTGATGCCCAGGGGCAGATGTGG + Intronic
1022468578 7:30667406-30667428 TTGCTGCCCTAGGAGAGCTGAGG - Intronic
1023545693 7:41315940-41315962 CAGATGCCCCTGGCCAGCTGAGG + Intergenic
1023585629 7:41726812-41726834 CTGCTGAAGTTGGGCATCTGAGG - Intergenic
1023598098 7:41853683-41853705 CTGCTTCCCTGGGACACCTGAGG + Intergenic
1023979619 7:45061023-45061045 TTGCTGCCCTTGTGATGCTGGGG + Intronic
1024240018 7:47427589-47427611 CTTCTGGCCCTGGGCAGCTGTGG - Intronic
1025210913 7:57019263-57019285 CAGCTGTCCTTGGGGGGCTGGGG - Intergenic
1025661042 7:63557584-63557606 CAGCTGTCCTTGGGGGGCTGGGG + Intergenic
1026995410 7:74612722-74612744 CTGCTGGGCCTGGGCCGCTGGGG - Intergenic
1029290191 7:99496495-99496517 CTGCTGCCCTTTGCCTGCTCTGG - Intronic
1031206719 7:118768106-118768128 GTGCTGCCATTAGGCAGCTGAGG + Intergenic
1033195231 7:139321790-139321812 CTGCTGTCCTGGGGAAGCAGGGG - Intergenic
1033951793 7:146793713-146793735 CTCCAGCCTTTGGGCAGCTGTGG + Intronic
1034400041 7:150856310-150856332 AGGCTGTCCTGGGGCAGCTGGGG - Intronic
1034530992 7:151696423-151696445 CTGGTGGCCTGGGGCAGGTGAGG + Intronic
1034786337 7:153929147-153929169 CTTCAGCCCTTGGTCACCTGTGG - Intronic
1035166423 7:156993119-156993141 CAGCTGCCCCTAGGGAGCTGCGG - Intergenic
1035890809 8:3340658-3340680 TTGATGACCTTGGGGAGCTGGGG + Intronic
1038338154 8:26661934-26661956 CCGCTTCCCTGGGGCCGCTGGGG - Intergenic
1039895523 8:41714116-41714138 CTGCTCTCCAGGGGCAGCTGGGG + Intronic
1040545165 8:48393325-48393347 CTGCTGCCCCTGGGAATCTCTGG + Intergenic
1040911172 8:52520797-52520819 CTGATGCCCAGGGGCATCTGTGG + Intergenic
1041766218 8:61420853-61420875 CAGCTACCCTTGGGAGGCTGAGG + Intronic
1042017502 8:64331374-64331396 ATGCTGCCTTTGGTCAGCTAAGG + Intergenic
1042263691 8:66886657-66886679 CAGCTACACTTGGGAAGCTGAGG + Intronic
1042359523 8:67866892-67866914 CTCCTGCCCTTCAGCAACTGTGG - Intergenic
1044531887 8:93316659-93316681 GTGCTGCCCGAGGGCATCTGTGG - Intergenic
1045557605 8:103229912-103229934 CTGCCAACCTTTGGCAGCTGGGG - Exonic
1047097413 8:121640018-121640040 GCGCTGCGCTTCGGCAGCTGCGG - Intronic
1048214559 8:132482219-132482241 CTGCTGCCCCATGGCATCTGTGG + Intergenic
1048297192 8:133223140-133223162 TTGCTGCCCTGGGGCTGCTGGGG - Intronic
1048819212 8:138364305-138364327 ATCCTGCCTTTGGGCAGCTGTGG - Intronic
1049094137 8:140538479-140538501 CTCCTGCCTTTCGTCAGCTGTGG + Intronic
1049095813 8:140547462-140547484 CTGCTGCCCCAGGGCAGGTGAGG - Exonic
1049229721 8:141475623-141475645 CCGCTTCCCTTGGGCTGCTGGGG + Intergenic
1049415646 8:142493657-142493679 CTGCTGCCTGTGAGGAGCTGAGG + Intronic
1049459455 8:142717928-142717950 CAGCCGCCCTGGGGCACCTGGGG - Intergenic
1049512969 8:143039004-143039026 ATCCCGCCCTGGGGCAGCTGGGG - Intergenic
1049644453 8:143729818-143729840 CGGTGGCCCTTGGCCAGCTGAGG - Intronic
1049807874 8:144549051-144549073 CTGGTGCCCTTGGCCAGGTGCGG - Intronic
1050018445 9:1260043-1260065 CTGCTGCAGTGGGGTAGCTGTGG + Intergenic
1051365294 9:16317422-16317444 CTGCTCCTCTGGGGCAGTTGGGG + Intergenic
1051843056 9:21420198-21420220 CTGCTGGCCTGGTGGAGCTGGGG - Intronic
1052844191 9:33320394-33320416 GTGGTGCCCTTGGCCTGCTGAGG + Intronic
1054777327 9:69134550-69134572 ATCCTGCCCTCTGGCAGCTGAGG - Intronic
1055583360 9:77731382-77731404 CTGCTGCACTGGGGCTGCTCTGG + Intronic
1057075290 9:92135336-92135358 TCCCTGCCCTTAGGCAGCTGGGG + Intergenic
1057333958 9:94141740-94141762 CTGCTCCCCTTGGACACCAGCGG - Intergenic
1057464562 9:95300880-95300902 GTGCAGCCCTTGGCCTGCTGCGG - Intronic
1057980016 9:99650922-99650944 CTGCTGCACTGGGGAAGCGGAGG - Intergenic
1058636071 9:107039969-107039991 CTGATGCCCTGGGGTGGCTGAGG - Intergenic
1058668661 9:107342474-107342496 CTGCAGCCCCTGGGCAGGGGAGG + Intergenic
1058868631 9:109183752-109183774 CTGCTGCCCCTGGGCAGTGGTGG - Intronic
1061211095 9:129193926-129193948 CTGCCTCCCAGGGGCAGCTGGGG + Intergenic
1061379352 9:130244771-130244793 CTGCTGCCCTGTGGCCACTGGGG - Intergenic
1061466587 9:130785359-130785381 CTGCTGCCCTGGGCCAGCTCTGG + Intronic
1061806365 9:133139718-133139740 CCGCTGCCCTTGGGGAGCCAGGG - Intronic
1061859086 9:133458999-133459021 CTGCTGCCCATGGAACGCTGTGG - Exonic
1061957505 9:133971313-133971335 CGGCTGCCCCTGGGCTGCCGTGG - Intronic
1062103838 9:134741973-134741995 CTGCTCCCTGTGGGCAGCCGTGG + Intronic
1062239105 9:135526363-135526385 GTGCCGTCCTTGGGCTGCTGAGG - Exonic
1062271387 9:135711345-135711367 GTGCTGCCTTTGGCCAGCTGGGG - Intronic
1062598598 9:137310146-137310168 CCACTGCCCTGGGGCAGGTGTGG + Intronic
1062629339 9:137456805-137456827 CTGTTTCCCTTGGGCAGAAGAGG + Intronic
1186510425 X:10125986-10126008 CAGCCCCCTTTGGGCAGCTGTGG - Intronic
1186844691 X:13518862-13518884 CTGCTGCTCTTGGCCATCTCAGG - Intergenic
1188091348 X:25968760-25968782 CTGGTTCCCTTGGTCAGTTGGGG + Intergenic
1193808819 X:86026419-86026441 CTGCTGCCTTGGGCCAGGTGTGG - Intronic
1194234975 X:91372173-91372195 CTGCTGCCCTTGGTCAGGTGAGG + Intergenic
1196893179 X:120309636-120309658 CTGCTTACCTTGGCCAGCTGTGG - Intronic
1197761480 X:130031113-130031135 CTGCTGCTCTCTGGCAGCTTTGG + Intronic
1200162838 X:154018207-154018229 CTGGCTCCCTTGGGCACCTGAGG - Intronic
1200234744 X:154462769-154462791 CTGCTTCCATTGGGGATCTGGGG + Intronic
1200784220 Y:7245287-7245309 CTGATGCCTTTGGGAGGCTGAGG - Intergenic
1200966766 Y:9045963-9045985 CTGCTTTCCTTGAGCAGCTGTGG + Intergenic
1201270499 Y:12249309-12249331 CTGCAGGCTTTAGGCAGCTGTGG - Intergenic
1202378004 Y:24255636-24255658 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1202492778 Y:25414485-25414507 CTGCTGCCCCTGGGCCACTCTGG - Intergenic