ID: 1146876671

View in Genome Browser
Species Human (GRCh38)
Location 17:36418938-36418960
Sequence TTTTTGAAGGGCATTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 849
Summary {0: 3, 1: 0, 2: 2, 3: 37, 4: 807}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146876671 Original CRISPR TTTTTGAAGGGCATTGTGGT TGG Intronic
901270738 1:7951482-7951504 TTTTTGAAGCACATTGTGGCAGG + Intergenic
902337553 1:15762502-15762524 TTTTTGGAGGGCAAGGTGGTTGG - Intronic
902968115 1:20026040-20026062 TGTTTGATGGGCATTTGGGTTGG + Intergenic
903097616 1:20993603-20993625 TTTTTGAAGGAATTTGTTGTTGG - Intronic
905081549 1:35326438-35326460 TTTCTGAACTGCATGGTGGTAGG - Intronic
905579970 1:39076851-39076873 TTTGGGAAGGGCATTGAGGTTGG + Intergenic
905861764 1:41356826-41356848 TCTTTGCAGGGCTTTGTGCTTGG + Intergenic
906893791 1:49748407-49748429 TCATTGATGGGCATTTTGGTTGG + Intronic
906903408 1:49862788-49862810 TATTTGAAGGGTATTTTTGTTGG - Intronic
907813072 1:57891602-57891624 TTATTGATGGGCATTTGGGTTGG - Intronic
908614198 1:65899565-65899587 TGATTGATGGGCATTGAGGTTGG - Intronic
908883852 1:68764839-68764861 TTTTTCATGGGCATTCTGGTTGG - Intergenic
909011494 1:70340091-70340113 TTTTGGAAGGGCAAGGTGGGAGG - Intronic
909141010 1:71865329-71865351 TCATTGATGGGCATTTTGGTTGG - Intronic
909472997 1:76050324-76050346 TCATTGATGGGCATTTTGGTTGG + Intergenic
909689746 1:78393968-78393990 TTATTGATGGGCATTTGGGTTGG + Intronic
909698012 1:78489447-78489469 TTATTGATGGGCATTTGGGTTGG - Intronic
909893589 1:81037661-81037683 TTTTTAATGGACATGGTGGTGGG - Intergenic
910655261 1:89611736-89611758 TTTTTGCTAGGCATTGTAGTAGG + Intergenic
910681917 1:89875184-89875206 TTTTTGACAGGCATTGCTGTTGG + Intronic
910697989 1:90041983-90042005 TTTTTGAACTGCATGGTGGGAGG + Intergenic
911018976 1:93367278-93367300 TTTTTGAACTGCATGGTGGTAGG - Exonic
911240369 1:95458875-95458897 TTATTGATGGGCATTTGGGTTGG - Intergenic
911318601 1:96384782-96384804 TGATTGATGGGCATTTTGGTTGG - Intergenic
911498438 1:98658438-98658460 TTTTTGGAGAGCATTGTTGTGGG - Intergenic
911555816 1:99343293-99343315 TTATTGATGGGCATTTGGGTTGG - Intergenic
911746462 1:101446537-101446559 TGATTGATGGGCATTTTGGTTGG + Intergenic
912066255 1:105747281-105747303 TCTTTGATGGGCATTTGGGTTGG + Intergenic
913102198 1:115578629-115578651 TTATTGAAGGACATTTGGGTTGG + Intergenic
913168657 1:116212293-116212315 TCATTGATGGGCATTTTGGTTGG - Intergenic
913201876 1:116501447-116501469 TTGTTGAAGGGAAATGGGGTAGG + Intergenic
913429794 1:118777811-118777833 TTATTGATGGGCATTTGGGTTGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
913708231 1:121450055-121450077 TTTTTGAGCTGCATAGTGGTAGG - Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915298011 1:154935351-154935373 CTCTTGAAGGCCAGTGTGGTGGG - Intronic
915606460 1:156955100-156955122 TCTGTGAAGGGCAGTGGGGTGGG - Intronic
915628112 1:157129213-157129235 TTATTGAAAGGCATTTTAGTGGG + Intronic
915769936 1:158410558-158410580 GTTTTGAACTGCCTTGTGGTAGG + Intergenic
915779136 1:158526372-158526394 TTTTTGAAAAGCTTTGTGATAGG - Intergenic
915780521 1:158544933-158544955 TTATTGATGGGCATTGTGGTTGG + Intergenic
916413467 1:164570604-164570626 TCATTGATGGGCATTTTGGTTGG + Intronic
916874473 1:168954090-168954112 TTATTGATGGGCATTTGGGTTGG + Intergenic
916890468 1:169107783-169107805 ATTTTGAAGGGCAGAGTTGTAGG + Intronic
916978084 1:170103315-170103337 TTATTGATGGACATTGGGGTTGG + Intergenic
917053733 1:170955215-170955237 TTGTTGATGGGCATTTGGGTTGG + Intronic
917685276 1:177409532-177409554 TTATTGATGGGCATTTTGGTTGG - Intergenic
918502196 1:185209621-185209643 TCATTGAAGGGCATTTGGGTTGG + Intronic
918593496 1:186265855-186265877 TTATTGATGGGCATTTGGGTTGG + Intergenic
918623671 1:186633848-186633870 GTTTTTAAGGGCAATTTGGTGGG - Intergenic
918807026 1:189061129-189061151 TTATTGATGGGCATTTGGGTTGG - Intergenic
918989554 1:191681200-191681222 TTATTGATGGGCATTTAGGTTGG + Intergenic
919136054 1:193509126-193509148 TCATTGATGGGCATTTTGGTTGG + Intergenic
919457402 1:197836467-197836489 TTATTGATGGGCATTTGGGTTGG - Intergenic
919602416 1:199638595-199638617 TCTTTGATGGGCATTTGGGTTGG - Intergenic
920064149 1:203253933-203253955 TTTTTGAAGGACAGTTTTGTTGG + Intronic
920273472 1:204785275-204785297 TCTTTGATGGGCATTTGGGTTGG + Intergenic
920404160 1:205696655-205696677 TTTTTAAAGGTCATTTTGGGAGG + Intergenic
920640684 1:207749103-207749125 CTTATGAAGGGCAGTGTGGGTGG - Intergenic
920784450 1:209027429-209027451 TTTTTGAAGGGGAAGGTGGGGGG + Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921565167 1:216708808-216708830 TCATTGAAGGGCATTTGGGTTGG - Intronic
921976835 1:221212151-221212173 TTATTGATGGGCATTTGGGTTGG - Intergenic
922377657 1:224985210-224985232 TGTTTGATGGGCATTTGGGTTGG - Intronic
922747316 1:228051656-228051678 TTTTATAAGGGCATTGTTTTAGG + Intronic
923287658 1:232512464-232512486 TCATTGATGGGCATTGGGGTTGG - Intronic
923416091 1:233761984-233762006 TTCTTGATGAGCATTTTGGTTGG + Intergenic
923440198 1:234011284-234011306 TTTTTGAACTGCATGTTGGTTGG - Intronic
923871847 1:238003784-238003806 TCATTGATGGGCATTTTGGTTGG - Intergenic
924402155 1:243695802-243695824 TTTTTGGAGGCCAGTGTTGTAGG - Intronic
924918805 1:248604258-248604280 TCATTGATGGGCATTTTGGTTGG - Intergenic
1063291275 10:4752263-4752285 TTGTTGATGGGCATTTGGGTTGG + Intergenic
1063469423 10:6272544-6272566 TTTTAGCTGGGCATGGTGGTGGG + Intergenic
1063797257 10:9526177-9526199 TTTTTGAAGGGCATTTTTCAAGG + Intergenic
1064183461 10:13139791-13139813 TTTTTGAAGGACAGTTTGGCTGG + Intergenic
1064389155 10:14926503-14926525 TTTTAGCTGGGCATGGTGGTGGG + Intronic
1064728199 10:18302440-18302462 TTATTGATGGGCATTTGGGTTGG - Intronic
1064768893 10:18703287-18703309 TTTTTGCCGGGCATGGTGGCAGG - Intergenic
1065030286 10:21579101-21579123 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1065405583 10:25359655-25359677 TCATTGATGGGCATTTTGGTTGG + Intronic
1065825161 10:29564067-29564089 TTTTTGCAGGGCCGTGTGGAGGG - Intronic
1066066376 10:31764207-31764229 TTATTGATGGGCATTTGGGTTGG - Intergenic
1066150477 10:32610819-32610841 TCATTGATGGGCATTTTGGTTGG + Intronic
1066271342 10:33827289-33827311 TCATTGATGGGCATTTTGGTTGG - Intergenic
1067168402 10:43883674-43883696 GTTTTTAAGGGCATTGTTCTGGG - Intergenic
1067413503 10:46085649-46085671 TTTTAGTATGGCATGGTGGTGGG - Intergenic
1068149937 10:53118879-53118901 TTTTTCAAGGCCAGTTTGGTGGG - Intergenic
1068347034 10:55794746-55794768 TCATTGATGGGCATTTTGGTTGG - Intergenic
1068418729 10:56761661-56761683 TATTTTAATGGCAATGTGGTTGG + Intergenic
1068718442 10:60214758-60214780 TTGTTGATGGGCATTTGGGTTGG + Intronic
1069036101 10:63647751-63647773 TTATTGATGGGCATTTGGGTTGG + Intergenic
1069509834 10:69033914-69033936 TCTTAGCCGGGCATTGTGGTGGG + Intergenic
1069703752 10:70444079-70444101 TTTTAGCCGGGCATGGTGGTGGG - Intronic
1069934998 10:71909318-71909340 TTTTTCAAGGACAGTTTGGTGGG + Intergenic
1070130055 10:73649485-73649507 TTGTTGAAGTGCTGTGTGGTGGG - Intronic
1070245306 10:74725608-74725630 TTTTTGAAGGATATTTTTGTTGG - Intergenic
1071192506 10:83118256-83118278 TGTTTGAACTGCATGGTGGTGGG + Intergenic
1071212954 10:83365792-83365814 TTTGTGCAGGACATTGGGGTAGG + Intergenic
1071432741 10:85619102-85619124 TCTGTGAAGGGCATTTTGCTGGG - Intronic
1071765763 10:88663262-88663284 TTATTGATGGGCATTTGGGTTGG - Intergenic
1071971371 10:90911247-90911269 TTATTGATGGGCATTTGGGTTGG - Intergenic
1072075109 10:91963268-91963290 TTTTTAAAAGGCATGGTGGCGGG + Intronic
1073487789 10:103831574-103831596 TTTTGGAAGGCCAGTGTGGGAGG + Intronic
1073936936 10:108643691-108643713 TCATTGAAGGGCATTTGGGTTGG + Intergenic
1073962872 10:108954279-108954301 TTATTGATGGGCATTTGGGTTGG - Intergenic
1074194330 10:111167789-111167811 TTGTTGATGGGCATTTGGGTTGG + Intergenic
1075260231 10:120957178-120957200 TTTTGGAAGGTCATTGGGTTTGG - Intergenic
1075262722 10:120977023-120977045 TCAGTGCAGGGCATTGTGGTAGG - Intergenic
1075925688 10:126250130-126250152 ACTTTGAAGGGCCTTGCGGTCGG - Intronic
1076027565 10:127128838-127128860 TCTTTGATGGGCATTCAGGTTGG - Intronic
1076069658 10:127477469-127477491 TTATTGATGGGCATTTGGGTTGG + Intergenic
1076201276 10:128560604-128560626 TTTTTCAAAAGCATTTTGGTTGG - Intergenic
1077275567 11:1705766-1705788 TTTTTCCAGGACAGTGTGGTGGG + Intergenic
1077508758 11:2944393-2944415 TCTTTGCAGGGGAATGTGGTGGG - Intergenic
1077790019 11:5429193-5429215 TTTTTCAAGGGTAGTTTGGTGGG - Intronic
1078586276 11:12592481-12592503 TGTATGACGGGCATTGTGCTAGG + Intergenic
1078718538 11:13862112-13862134 TTTTTGATGGGGACTGTTGTGGG + Intergenic
1078918438 11:15803119-15803141 TTATTGATGGGCATTTGGGTTGG + Intergenic
1079715434 11:23737629-23737651 GTATTGATGGGCATTTTGGTTGG - Intergenic
1079959191 11:26901876-26901898 TCATTGATGGGCATTTTGGTTGG - Intergenic
1080090340 11:28340915-28340937 TTATTGATGGGCATTTGGGTTGG - Intergenic
1080130398 11:28787764-28787786 TTTTTGATGGGCATATTTGTTGG + Intergenic
1080192001 11:29562154-29562176 TTTTTGTAAGGCATTATGATAGG + Intergenic
1080220806 11:29901245-29901267 TTATTGATGGGCATTTGGGTTGG + Intergenic
1080637016 11:34133102-34133124 TTCTGGAAGGGCATTCTGGGTGG - Exonic
1080734994 11:35005015-35005037 TTATTGATGGGCATTTGGGTTGG + Intronic
1081066909 11:38553896-38553918 TTTTTGAAGGTACTTGTGCTTGG - Intergenic
1081118662 11:39236505-39236527 TTATTGATGGGCATTTGGGTTGG - Intergenic
1081204779 11:40262576-40262598 TCATTGATGGGCATTTTGGTTGG - Intronic
1081339676 11:41912470-41912492 TTGTTGATGGGCATTTGGGTTGG + Intergenic
1081409263 11:42737416-42737438 TCATTGATGGGCATTTTGGTTGG + Intergenic
1081435255 11:43020828-43020850 TTTATGAATGGCATTGAGGTAGG + Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1083141690 11:60727158-60727180 TTGTTGAGGGGCATTTGGGTTGG + Intergenic
1083861139 11:65420847-65420869 CTTTTGAAGGCCATGGTGGGAGG - Intergenic
1084064834 11:66697933-66697955 TTTCTCAAGGGCATGATGGTTGG - Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084511620 11:69608926-69608948 TTTTTGAAGGGTATTGTCACTGG - Intergenic
1084856583 11:71992199-71992221 TTTTTGAACTGCACAGTGGTAGG + Intronic
1085213466 11:74804450-74804472 TTTTTGCACTGCATGGTGGTAGG + Intronic
1086209541 11:84301942-84301964 TTATTGACGGGCATTTGGGTTGG - Intronic
1086243751 11:84726510-84726532 TTTTTGATGGACATTTGGGTTGG + Intronic
1086260400 11:84932758-84932780 TCTTTGATGGGCATTTGGGTTGG + Intronic
1086514350 11:87594709-87594731 TTATTGATGGGCATTTGGGTCGG - Intergenic
1086582251 11:88412506-88412528 TTATTGATGGGCATTTGGGTTGG + Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1086836084 11:91624937-91624959 TGATTGATGGGCATTGGGGTTGG - Intergenic
1086929204 11:92673935-92673957 TTTTGGAAGGCCAAAGTGGTTGG + Intronic
1087399036 11:97640920-97640942 TTATTGATGGGCATTTGGGTTGG - Intergenic
1087442186 11:98200797-98200819 TCTTTGATGGGCATTTGGGTTGG + Intergenic
1087975765 11:104544642-104544664 TTGTTGATGGGCATTTGGGTTGG - Intergenic
1087980345 11:104605507-104605529 TTATTGATGGGCATTTGGGTTGG - Intergenic
1088034215 11:105292205-105292227 TTATTGATGGGCATTTGGGTTGG + Intergenic
1088670279 11:112133642-112133664 GTCTTGAAAGGCATTGTGTTAGG + Intronic
1088677504 11:112209465-112209487 TTATTGAAGGACATCTTGGTTGG + Intronic
1088830879 11:113535873-113535895 TTATTGATGGGCATTTGGGTTGG - Intergenic
1089947945 11:122496737-122496759 TCATTGATGGGCATTTTGGTTGG + Intergenic
1090486940 11:127121488-127121510 TTTTTGAACTGCATGATGGTAGG + Intergenic
1090524137 11:127511503-127511525 TCTTTGATGGGCATTTGGGTTGG + Intergenic
1091298235 11:134488404-134488426 TTTTTGAAGGTGATTCTGCTGGG - Intergenic
1091351142 11:134895739-134895761 TTTTTGAAGTATATTGTTGTTGG + Intergenic
1091972465 12:4798918-4798940 TTTGTGAAGGACATTGTGCTAGG + Intronic
1092187370 12:6490757-6490779 TTGTTGCGGGGCATGGTGGTTGG - Intergenic
1092322769 12:7496069-7496091 TTATTGATGGGCATTTGGGTTGG - Intronic
1092691386 12:11114249-11114271 TATTTGATGGGCATTTGGGTTGG - Intronic
1092968925 12:13672737-13672759 TTTTTGTAGGGCATTTGGGAGGG - Intronic
1093057783 12:14571893-14571915 TTTTTGAAGGCCAAGGTGGGAGG - Intergenic
1093069865 12:14697458-14697480 TTATTGATGGGCATTTGGGTTGG + Intergenic
1093328906 12:17811700-17811722 TTTTTAAAGGGCAATTTCGTCGG + Intergenic
1093610283 12:21147679-21147701 TTATTGATGGGCATTTGGGTTGG + Intronic
1094018600 12:25890422-25890444 TTTTTGAACTGCATGGTGGAAGG - Intergenic
1094148197 12:27252857-27252879 TATTTGCAGGGCACTGTGTTAGG + Intronic
1094199917 12:27784668-27784690 TTTTTGATGGGCAATTTGGCGGG - Intronic
1095267760 12:40180290-40180312 GTTTTTAAGGGCAATTTGGTGGG - Intergenic
1095406805 12:41875886-41875908 TTATTGATGGGCATTTGGGTTGG - Intergenic
1095547049 12:43384853-43384875 TTCTTGATGGGCATTTGGGTTGG + Intronic
1095877378 12:47096582-47096604 TTTATGAAAGGTATTGTGTTAGG - Intronic
1097592979 12:61594060-61594082 TCTTTGATGGGCATTTGGGTTGG - Intergenic
1097719223 12:63002287-63002309 TTATTGATGGGCATTGGGGTTGG + Intergenic
1097762539 12:63484681-63484703 TCATTGATGGGCATTTTGGTTGG - Intergenic
1098717354 12:73847449-73847471 TTATTGATGGGCATTTGGGTTGG - Intergenic
1099217145 12:79867064-79867086 TCATTGATGGGCATTTTGGTTGG - Intronic
1099258635 12:80347538-80347560 TTATTGATGGGCATTTGGGTTGG + Intronic
1099377425 12:81908776-81908798 TCATTGATGGGCATTGGGGTTGG + Intergenic
1099405292 12:82252341-82252363 TTTTTTAAAGCCATTCTGGTAGG + Intronic
1099576010 12:84382514-84382536 TCATTGAAGGGCATTTGGGTTGG + Intergenic
1099881961 12:88477969-88477991 TTGTTGATGGGCATTTGGGTTGG - Intergenic
1099926738 12:89027760-89027782 TTTATTATGGGAATTGTGGTAGG - Intergenic
1100108453 12:91207146-91207168 TTATTGATGGGCATTTGGGTTGG + Intergenic
1100178389 12:92056990-92057012 TCATTGATGGGCATTTTGGTGGG + Intronic
1100614298 12:96219023-96219045 TTTTTGAAGCTCAGAGTGGTGGG + Intronic
1101045793 12:100804348-100804370 TCTTTGATGGGCATTTAGGTTGG + Intronic
1101259653 12:103015223-103015245 GTTTTGTTGGGCATTGTGGAAGG - Intergenic
1101277656 12:103220005-103220027 TTATTGATGGGCATTTGGGTTGG - Intergenic
1101291603 12:103376150-103376172 TCATTGATGGGCATTTTGGTTGG - Intronic
1101405713 12:104426756-104426778 CTTTTGAAGGGGATCGGGGTGGG + Intergenic
1101980367 12:109401084-109401106 GTTTTGAAGGGCATTCCCGTAGG + Exonic
1102190268 12:110982500-110982522 ATTTTTAAGGGCATGTTGGTAGG + Intergenic
1102228055 12:111243100-111243122 TCATTGATGGGCATTTTGGTAGG + Intronic
1104100498 12:125604190-125604212 TCATTGATGGGCATTTTGGTTGG - Intronic
1104337059 12:127908997-127909019 AATTAGCAGGGCATTGTGGTGGG + Intergenic
1105988615 13:25594927-25594949 TGTTTGATGGGCATTTGGGTTGG - Intronic
1107960867 13:45556833-45556855 TTGTTGAAGGGCATTTGGGTTGG + Intronic
1108151219 13:47536807-47536829 TCATTGATGGGCATTTTGGTTGG - Intergenic
1108219674 13:48220555-48220577 TTGTTGATTGGCATTGTGTTAGG - Intergenic
1109127744 13:58539146-58539168 TTATTGATGGACATTTTGGTTGG - Intergenic
1109722289 13:66290310-66290332 TTTTTGGAGGCCAGTGTGGGAGG + Intergenic
1109899878 13:68753668-68753690 TCATTGATGGGCATTGGGGTTGG - Intergenic
1110199190 13:72828679-72828701 TTATTGAAGGACATTTGGGTCGG + Intronic
1110867830 13:80417391-80417413 TTTTTGAAAGACATTTTGCTGGG + Intergenic
1110961690 13:81634103-81634125 TGTTTGAAGAGGATCGTGGTGGG - Intergenic
1111126441 13:83914642-83914664 TTTTTCAAGGACAGTTTGGTGGG - Intergenic
1111377999 13:87405862-87405884 TTATTGATGGGCATTTGGGTTGG - Intergenic
1111993759 13:95142177-95142199 TTGTTGATGGGCATTTGGGTTGG - Intronic
1112094569 13:96118113-96118135 TTTTTGGAGGCCAATGTGGGTGG - Intronic
1112105162 13:96232022-96232044 GTTCTGAAGGGGAGTGTGGTAGG + Intronic
1112945867 13:104926227-104926249 TGATTGATGGGCATTTTGGTTGG - Intergenic
1114222905 14:20712966-20712988 TTTTTAGAGGGCACTGTGTTTGG + Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1115606563 14:35009033-35009055 ATTTAGATGGGCATGGTGGTGGG - Intronic
1115970327 14:38938424-38938446 TTTTTGATGGGCATTTGGGTTGG - Intergenic
1116471346 14:45289066-45289088 AATTAGACGGGCATTGTGGTGGG + Intergenic
1116554311 14:46284033-46284055 TTATTGATGGGCATTTGGGTTGG + Intergenic
1116690845 14:48103854-48103876 TTTTTCAAGGACAGTTTGGTTGG + Intergenic
1116785193 14:49280469-49280491 TTCATGAAGGGCATCGTTGTGGG - Intergenic
1117465978 14:55994440-55994462 TTATTGATGGGCATTTGGGTTGG + Intergenic
1117589917 14:57256620-57256642 TTCTTGAAGGGCAATCTGGATGG - Intronic
1117781109 14:59233035-59233057 TTATTGATGGGCATTAGGGTTGG + Intronic
1118499919 14:66350792-66350814 ATTTTGAAGGGCAGAGTTGTTGG - Intergenic
1118620576 14:67610787-67610809 TTTTTTAAGGGTACTTTGGTAGG - Intergenic
1118946560 14:70393546-70393568 TTGTTGATGGGCATTTGGGTTGG - Intronic
1118977434 14:70689798-70689820 TTTTTGGAGGGCAAGGTGGAAGG + Intergenic
1120876965 14:89383936-89383958 TTTTAGCTGGGCATGGTGGTGGG - Intronic
1121183970 14:91950550-91950572 ATTTTGGAGGGCATTGTGTAGGG - Intergenic
1121346310 14:93138212-93138234 TTCTGGAAGAGCATTCTGGTGGG + Intergenic
1121398951 14:93654765-93654787 TTTTCCAAGGGCAGAGTGGTGGG + Intronic
1122252037 14:100446614-100446636 TTTTTGAAGTGAATTATGATTGG - Intronic
1123162959 14:106297491-106297513 TCTTTGATGGGCATTTGGGTTGG + Intergenic
1123834963 15:24180058-24180080 TGATTGATGGGCATTGGGGTTGG + Intergenic
1123870682 15:24568915-24568937 TGATTGATGGGCATTGAGGTTGG + Intergenic
1124025593 15:25962438-25962460 TTTTTGAAAGGCATTTTTGGGGG + Intergenic
1124417841 15:29488827-29488849 TTTTTCAAGGGTATTTTTGTAGG - Intronic
1124437542 15:29663457-29663479 TCATTGATGGGCATTTTGGTTGG - Intergenic
1125057966 15:35385361-35385383 TTATTGATGGGCATTTGGGTTGG - Intronic
1125313341 15:38404140-38404162 TGATTGATGGGCATTTTGGTTGG + Intergenic
1126056189 15:44731950-44731972 TTTTTGCAGGGAATTATGGTGGG - Intronic
1127154871 15:56113246-56113268 TCATTGATGGGCATTTTGGTTGG - Intronic
1127859909 15:62985278-62985300 TTTGTGAAGGGTAATGAGGTGGG - Intergenic
1128076488 15:64829561-64829583 GTTTTCAAGGTCATTATGGTAGG + Intergenic
1129027923 15:72596201-72596223 TTTTTGAGGGGTATTTTAGTTGG + Exonic
1130150448 15:81307556-81307578 TTTTTGAAGGTCAATTTGGAAGG + Intronic
1130442430 15:83968753-83968775 TTATTGATGGGCATTTGGGTTGG - Intronic
1131326388 15:91450937-91450959 TTATTGATGGGCATTTGGGTTGG + Intergenic
1131990853 15:98091366-98091388 TATTTGCAGGGCATTGTGGATGG + Intergenic
1132099251 15:99011738-99011760 TATTTGAAGGGCATTGTGGATGG - Intergenic
1132624440 16:884448-884470 TTTTTGAAAGAGATTGTTGTTGG - Intronic
1133534605 16:6689034-6689056 TTATTGATGGGCATTTGGGTTGG + Intronic
1133669363 16:8003014-8003036 TAATTGATGGGCATTTTGGTTGG - Intergenic
1137046628 16:35669869-35669891 TTATTGATGGACATTGGGGTTGG - Intergenic
1137233422 16:46590911-46590933 TTTTTGATGGACATTTTTGTTGG - Intronic
1137278679 16:46956113-46956135 TTTTTTAAGGGGGTGGTGGTAGG + Exonic
1137307126 16:47213236-47213258 TATTTTAAGTTCATTGTGGTTGG + Intronic
1137532800 16:49292584-49292606 TTTTTGAAGGACAGTGTTGCAGG - Intergenic
1137944910 16:52724475-52724497 TTATTGATGGGCATTTAGGTTGG + Intergenic
1138906959 16:61348482-61348504 GTTGGGAAGGGTATTGTGGTGGG - Intergenic
1139308440 16:66007781-66007803 CTTCTGAAGCTCATTGTGGTGGG + Intergenic
1140150829 16:72363256-72363278 GTTTAGAAGAGCATTGTGATAGG - Intergenic
1140730120 16:77848784-77848806 TTATTGATGGGCATTTGGGTGGG - Intronic
1141069589 16:80941588-80941610 TTTTTGAACTGCATGGTAGTAGG - Intergenic
1142404155 16:89877383-89877405 TTTTTGAAAGCCAGTGTGCTGGG + Intronic
1142568011 17:853124-853146 TTTTAGCCGGGCATGGTGGTGGG - Intronic
1143416289 17:6753275-6753297 TTTTTAAATGGGATTGGGGTTGG + Intergenic
1143434970 17:6917213-6917235 TGATTGATGGGCATTTTGGTTGG - Intronic
1144013002 17:11168209-11168231 TTATTGATGGGCATTTGGGTTGG - Intergenic
1144291186 17:13827977-13827999 TCTTTGATGGGCATTTGGGTTGG + Intergenic
1144605449 17:16661426-16661448 TTTCTGAAGGGCAATCTGGCTGG + Intergenic
1145183695 17:20775601-20775623 TCTTTGCAGGGCATCGTGCTCGG - Intergenic
1146228165 17:31085370-31085392 TTTAGTAAGAGCATTGTGGTTGG - Intergenic
1146583863 17:34065120-34065142 TGTTTGATGGGCATTTGGGTTGG - Intronic
1146608350 17:34282767-34282789 TTATTGATGGGCATTTGGGTTGG - Intergenic
1146828345 17:36044282-36044304 TTTTTGAAGGCTATTTTAGTTGG + Intergenic
1146876671 17:36418938-36418960 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1146984197 17:37198413-37198435 TTTTAGAAGAGTATTGTGCTAGG - Intronic
1147062713 17:37893923-37893945 TTTTTGAAGGGCATTGTGGTTGG - Intergenic
1148934976 17:51157935-51157957 TTTTTTAAGGGCTTGGGGGTTGG - Intronic
1148948810 17:51290265-51290287 TATTAGCTGGGCATTGTGGTGGG + Intronic
1148967896 17:51452732-51452754 TTATTGATGGGCATTTGGGTTGG - Intergenic
1149229840 17:54520025-54520047 GTTTTGAACTGCATGGTGGTAGG - Intergenic
1149586335 17:57790091-57790113 TTTTTGCAGGGCTTGCTGGTGGG - Intergenic
1149878175 17:60259677-60259699 TTTTTGAACTGCAAGGTGGTAGG + Intronic
1150287509 17:63962344-63962366 TTCTTGAAGGCCACTGTGGTGGG - Intronic
1150546344 17:66161426-66161448 TTATTGATGGGCATTTGGGTTGG - Intronic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1150865630 17:68846634-68846656 TTATTGATGGGCATTTGGGTTGG - Intergenic
1151077495 17:71290225-71290247 TGTATGATGGGCATTGGGGTTGG + Intergenic
1151095274 17:71490292-71490314 TTTTAGCTGGGCATTGTGGCAGG + Intergenic
1152059532 17:78060134-78060156 TTTCTGAAAGCCTTTGTGGTGGG - Intronic
1155466686 18:26143589-26143611 TTTTTGAACTGAATGGTGGTAGG + Intronic
1155837481 18:30604058-30604080 TTATTGATGGGCATTTGGGTTGG + Intergenic
1155978267 18:32154988-32155010 TTTTTGAGCTGCATAGTGGTAGG + Intronic
1156125356 18:33898448-33898470 TTTTTCAAGGGCTATGTGGAAGG - Intronic
1156152605 18:34260284-34260306 TCATTGATGGGCATTTTGGTTGG + Intergenic
1156340884 18:36209736-36209758 TGGTTGATGGGCATTGAGGTTGG + Intronic
1156777752 18:40813850-40813872 TTATTGATGGGCATTTGGGTTGG + Intergenic
1157011520 18:43654922-43654944 TCATTGATGGGCATTTTGGTTGG - Intergenic
1157018679 18:43752064-43752086 TTTTTGAAGGACATTTTTGCTGG - Intergenic
1157069090 18:44385152-44385174 ATTTAGTTGGGCATTGTGGTGGG + Intergenic
1157706254 18:49809471-49809493 CTGTTGAAGGACATTGTTGTGGG - Intronic
1157955667 18:52094942-52094964 TCATTGATGGGCATTTTGGTTGG - Intergenic
1158281175 18:55829639-55829661 TTTTAGAAAGGCTTTGTGGGTGG + Intergenic
1158676324 18:59522585-59522607 TTTTTGAACTGTATTGTGGTAGG - Intronic
1159189908 18:65028016-65028038 TTGATGGAGGGGATTGTGGTAGG - Intergenic
1159228079 18:65566999-65567021 GTCTTCAAGGGCCTTGTGGTGGG - Intergenic
1159436359 18:68423172-68423194 TCATTGATGGGCATTGGGGTTGG - Intergenic
1159619934 18:70625335-70625357 ATTTCCCAGGGCATTGTGGTGGG + Intergenic
1160103975 18:75951962-75951984 TCTTTGATGGGCATTTGGGTTGG + Intergenic
1160626582 18:80212464-80212486 CTTTTGAACTGCATGGTGGTGGG + Intronic
1161110578 19:2467430-2467452 TTTTTCAAGGGCAGTTTTGTGGG - Intergenic
1164287757 19:23836415-23836437 TGATTGATGGGCATTTTGGTTGG + Intergenic
1164298740 19:23939364-23939386 TGATTGATGGGCATTTTGGTTGG + Intronic
1164397165 19:27876466-27876488 TTTTTCAGGGGAATTGTGGGTGG + Intergenic
1164419938 19:28080622-28080644 TTGTTGAATTCCATTGTGGTTGG - Intergenic
1164701913 19:30291085-30291107 TCATTGATGGGCATTTTGGTTGG + Intronic
1165616721 19:37208372-37208394 TATTTGTATAGCATTGTGGTGGG + Intronic
1166822623 19:45589867-45589889 TTTATGTAGGGCACTGTGCTGGG - Exonic
1167847394 19:52175843-52175865 TATTTGAAGGGCACTCTTGTTGG + Intergenic
1168086316 19:54050145-54050167 AATTTGCTGGGCATTGTGGTGGG - Intronic
1168529559 19:57117021-57117043 TTTTTGTAGGAGATTGGGGTGGG + Intergenic
925095461 2:1195124-1195146 TCTTTGATGGGCATTTGGGTTGG + Intronic
926927201 2:17999377-17999399 TTGTTGATGGGCATTTGGGTTGG - Intronic
926927573 2:18003114-18003136 TCATTGAAGGGCATTTGGGTTGG - Intronic
927517762 2:23682067-23682089 TTTTTGGAGGGGATGGTGGTGGG - Intronic
928357757 2:30635908-30635930 TTAGTGGAGGGCATTGTGCTAGG + Intronic
928694695 2:33837354-33837376 TATTTGCTGGGCATAGTGGTGGG + Intergenic
928826176 2:35423874-35423896 TGATTGAAGGGCATTTGGGTTGG + Intergenic
929361317 2:41094751-41094773 TTATTGAGGGGCATTTGGGTTGG - Intergenic
930175498 2:48297095-48297117 TCATTGATGGGCATTTTGGTTGG + Intergenic
930530986 2:52588000-52588022 TTATTGATGGGCATTTTGGTGGG + Intergenic
930672437 2:54165108-54165130 TTATTGATGGGCATTTGGGTTGG + Intronic
930987415 2:57607518-57607540 TTGTTGATGGGCATTTGGGTTGG - Intergenic
931660566 2:64558624-64558646 TTTTTGAATTGTATGGTGGTAGG - Intronic
932871152 2:75399686-75399708 TTGTTGATGGGCACTGAGGTTGG - Intergenic
933003302 2:76954973-76954995 TTTCTGAAGGATATTGTTGTTGG - Intronic
933166154 2:79078135-79078157 TTATTGATGGGCATTTGGGTTGG + Intergenic
933292364 2:80452321-80452343 TATTTGACAGGCATTGTGCTAGG + Intronic
933356953 2:81222961-81222983 TTGTTGATGGGCATTTGGGTTGG - Intergenic
933421210 2:82047410-82047432 TCATTGATGGGCATTTTGGTTGG - Intergenic
933654797 2:84878810-84878832 TGCTGTAAGGGCATTGTGGTTGG - Intronic
934185302 2:89667442-89667464 TTTTTGAACTGCATAGTGGGAGG + Intergenic
934317100 2:91932966-91932988 TTTTTGAACTGCATAGTGGGAGG - Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934933433 2:98446405-98446427 TGTAAGAAGGGCAGTGTGGTTGG + Intronic
935228799 2:101078119-101078141 TTTTTCAAGGATAGTGTGGTGGG - Intronic
935399959 2:102650065-102650087 TCGTTGATGGGCATTTTGGTTGG - Intronic
935459415 2:103311056-103311078 TCATTGAAGGGCATTTGGGTTGG + Intergenic
935465552 2:103394024-103394046 TTATTGAAGGGCATTTGGGTTGG - Intergenic
936098588 2:109554249-109554271 TTTTTGAATTACATCGTGGTAGG - Intronic
936851192 2:116900150-116900172 TGTTTGATGGGCATTTTGGCTGG + Intergenic
937212010 2:120280298-120280320 TCTTTGATGGGCATTTGGGTTGG - Intronic
937520415 2:122707069-122707091 TTTTTTAAGGACAGTTTGGTGGG - Intergenic
937819588 2:126294236-126294258 TTATTGATGGGCATTTGGGTTGG + Intergenic
938019582 2:127895148-127895170 TTTTTGGGGGGGAGTGTGGTGGG + Intergenic
938326843 2:130412667-130412689 TTGTTGATGGGCATTTGGGTTGG - Intergenic
938363101 2:130708792-130708814 TTGTTGATGGGCATTTGGGTTGG + Intergenic
938743216 2:134252405-134252427 ATTTTAATAGGCATTGTGGTGGG + Intronic
938973392 2:136452621-136452643 TTTTTTAAGGGTAATTTGGTGGG + Intergenic
939078766 2:137634653-137634675 TTTCTAAAGGGCATGGTGGCTGG + Intronic
939145529 2:138410366-138410388 ATTTTGCCGGGCATGGTGGTGGG - Intergenic
939424445 2:142016422-142016444 TTATTGATGGGCATTTGGGTTGG - Intronic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
939521901 2:143241895-143241917 TCTTTGAAGCTCATTGTAGTGGG - Intronic
939851318 2:147309139-147309161 TTATTGATGGGCATTTGGGTTGG + Intergenic
940135180 2:150427407-150427429 TTCTTGAAGTGCATGATGGTTGG - Intergenic
940230050 2:151441249-151441271 TTTTTGGAGAGCAATTTGGTAGG + Intronic
940730598 2:157385931-157385953 TCATTGATGGGCATTTTGGTTGG - Intergenic
940745633 2:157564699-157564721 TCATTGATGGGCATTGGGGTTGG - Intronic
940781222 2:157936164-157936186 TCTTAGAAGGGGAGTGTGGTTGG + Intronic
940786164 2:157983498-157983520 TGTTTGAAGGGCAATTTTGTGGG + Intronic
941119817 2:161515389-161515411 TCATTGATGGGCATTTTGGTTGG - Intronic
942307462 2:174622891-174622913 TCTTAGGAGGGCATTATGGTAGG - Intronic
942733118 2:179081096-179081118 TTATTGATGGACATTTTGGTTGG - Intergenic
943467785 2:188250810-188250832 TTTTAGAAGAGCATTGTAGTTGG - Intergenic
943504799 2:188741400-188741422 TTATTGATGGGCATTTGGGTTGG + Intronic
943959867 2:194250419-194250441 TCATTGACGGGCATTTTGGTTGG + Intergenic
943979079 2:194523631-194523653 TCATTGAAGGGCATTTGGGTTGG + Intergenic
943993723 2:194732912-194732934 TTATTGATGGGCATTTGGGTTGG - Intergenic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
944244473 2:197516821-197516843 TTTTTGTAGGGCATTATGTGTGG + Intronic
944971979 2:205003360-205003382 TTTTTGGGGGGCATTGGGGGTGG + Intronic
945026275 2:205622708-205622730 TTTTTGAACCGCATGATGGTGGG + Intergenic
945555299 2:211268146-211268168 TTATTGATGGACATTTTGGTTGG + Intergenic
946036957 2:216751612-216751634 TGTTTGATGGGCATTTGGGTTGG - Intergenic
946634793 2:221712792-221712814 TTTTTGGGGGGCATTGAGGTGGG - Intergenic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
1169039197 20:2479278-2479300 TTTTGGGAGGCCATTGTGGGAGG - Intronic
1169125299 20:3122963-3122985 GTTTTGAAGGGAGTTTTGGTTGG - Intronic
1169605550 20:7314767-7314789 TTTTTGATAGGCATTTGGGTTGG - Intergenic
1170375360 20:15694112-15694134 TGATTGATGGGCATTTTGGTTGG + Intronic
1170396367 20:15930384-15930406 TTTTAGAAGGACATTTTGGCTGG - Intronic
1170908979 20:20544614-20544636 TTATTGATGGGCATTTGGGTTGG - Intronic
1171441983 20:25172004-25172026 TCTTTGATGGGCATTTGGGTTGG - Intergenic
1173296319 20:41761688-41761710 TTATTGATGGGCATTTGGGTTGG + Intergenic
1173739777 20:45390996-45391018 TTTTTGAACTGCATGGTGGTAGG + Intronic
1174851695 20:54001678-54001700 TTTTTTAAGGTCAGTTTGGTGGG - Intronic
1174903236 20:54522824-54522846 TTTCTGAAGAGCTTTCTGGTTGG + Intronic
1176670099 21:9725634-9725656 TTCTTGAAGCTCCTTGTGGTCGG - Intergenic
1177022761 21:15883636-15883658 TTTTTGAAGGGCTTTTTTTTGGG + Intergenic
1177086102 21:16706646-16706668 TATTTGCTGGGCATGGTGGTGGG - Intergenic
1177183649 21:17770159-17770181 TTATTGATGGGCATTTGGGTTGG + Intergenic
1177598631 21:23281448-23281470 TTATTGATGGGCATTTGGGTTGG - Intergenic
1177671402 21:24234843-24234865 TTTTTGAAGGGCATTTTTCCTGG + Intergenic
1177752531 21:25303015-25303037 TTTTTAGAGGGCATTATGCTGGG + Intergenic
1177769498 21:25498704-25498726 ATTTTGAAGAGCAATGTTGTTGG - Intergenic
1177847785 21:26311279-26311301 TGATTGATGGGCATTTTGGTTGG - Intergenic
1178206639 21:30474966-30474988 TTCTTGATGGGCATTTGGGTTGG + Intergenic
1178267476 21:31157354-31157376 TTTTTGAACTGCATGATGGTAGG - Intronic
1178313922 21:31553754-31553776 TTGTTGAGGGGCCTTGAGGTAGG - Intronic
1178382600 21:32123356-32123378 CTGTTGGAGGGCAGTGTGGTAGG - Intergenic
1178605715 21:34035053-34035075 TTTTTGGTGGGCAGTGAGGTGGG + Intergenic
1180543457 22:16475479-16475501 TTTTTGAACTGCATAGTGGGAGG - Intergenic
1180599446 22:17006600-17006622 TTATTGATGGGCATTTGGGTTGG - Intronic
1181962293 22:26631092-26631114 TTTTTAAAGACCAATGTGGTCGG + Intergenic
1182742535 22:32578778-32578800 TTTTGGAAAAGCATTGTGTTAGG + Intronic
1183008237 22:34921805-34921827 TTCTTGATGGGCATTTGGGTTGG - Intergenic
1183020963 22:35025374-35025396 TTATTGATGGGCATTTGGGTTGG + Intergenic
1183107906 22:35627872-35627894 TTTTTCAAGGGAATGGTGGGAGG - Intronic
1183287464 22:36976524-36976546 TTTTTTAAGGGTACTTTGGTGGG - Intergenic
1184628834 22:45759687-45759709 TTTATGAAGGGCAGGGTGGCTGG - Intronic
1184632539 22:45794718-45794740 TTTTTGAAGGATATTTTGGCTGG - Intronic
949441911 3:4090659-4090681 TTTTTGAACTGCATGGTGGTTGG + Intronic
949612760 3:5719765-5719787 TCTTTGATGGGCATTTGGGTTGG - Intergenic
949639730 3:6022290-6022312 TCATTGATGGGCATTTTGGTTGG + Intergenic
950633820 3:14301417-14301439 TTTTTGAAAGGCATGGGGGAAGG - Intergenic
950755345 3:15166497-15166519 TCATTGATGGGCATTTTGGTTGG - Intergenic
950987689 3:17392761-17392783 TCTTTGATGGGCATTTGGGTTGG + Intronic
951240399 3:20279936-20279958 TTTTTGAAGGGAATATTGGGAGG + Intergenic
951323958 3:21280125-21280147 TCATTGAAGGGCATTTGGGTTGG + Intergenic
951343370 3:21516136-21516158 TTTTTCAAGGACAATTTGGTGGG - Intronic
951402976 3:22257684-22257706 TATTTAAAAGGCATTGTGGAGGG - Intronic
951716213 3:25649648-25649670 TTTTTGAAGGGCACTTTTGCTGG - Intronic
951954851 3:28242440-28242462 TTTTTGGAGGGAATGGTAGTTGG + Intronic
952138329 3:30449413-30449435 TTTCTGAAGAGCATTTTGTTGGG - Intergenic
952477228 3:33722956-33722978 TTCAAGAAGGGCATTGTGTTAGG + Intergenic
952640471 3:35588349-35588371 TTATTGATGGGCATTTGGGTTGG - Intergenic
952780898 3:37097289-37097311 TTTTTTAAAGACTTTGTGGTTGG - Intronic
952926091 3:38320142-38320164 TTTTTAGTGGGCATGGTGGTGGG + Intergenic
953580344 3:44148397-44148419 TAATTGATGGGCATTTTGGTTGG + Intergenic
953610239 3:44441696-44441718 TTTTTACAGGGTAGTGTGGTGGG - Exonic
953746479 3:45577925-45577947 TTTTTGAAGGATAGTTTGGTGGG - Intronic
953895434 3:46795655-46795677 TAATTGATGGGCATTTTGGTTGG - Intronic
954490093 3:50895913-50895935 TCATTGAAGGGCATTTGGGTTGG + Intronic
955595592 3:60587096-60587118 TTATTGATGGGCATTTGGGTTGG - Intronic
955974147 3:64464451-64464473 TTTTTGATGGGCATTGCTTTGGG - Intergenic
956253214 3:67256138-67256160 TTATTGATGGGCATTTGGGTTGG - Intergenic
956369018 3:68537978-68538000 TTTTTCAAGGGTAGTTTGGTGGG + Intronic
956918766 3:73903783-73903805 TTATTGATGGGCATTTGGGTTGG + Intergenic
957249370 3:77753374-77753396 TCATTGATGGGCATTTTGGTTGG - Intergenic
957376985 3:79371083-79371105 TTATTGATGGGCATTTGGGTTGG + Intronic
957749042 3:84388387-84388409 TTTTTGGAGGGGGGTGTGGTGGG + Intergenic
957888473 3:86323571-86323593 TCTTTGAGGGGCATTTGGGTTGG - Intergenic
958467650 3:94477522-94477544 TCATTGATGGGCATTTTGGTTGG - Intergenic
958473806 3:94554984-94555006 TCATTGATGGGCATTTTGGTTGG - Intergenic
958562861 3:95770306-95770328 TTATTGATGGGCATTTGGGTTGG - Intergenic
959097043 3:101967349-101967371 TCATTGATGGGCATTTTGGTTGG + Intergenic
959237154 3:103739463-103739485 ATTTAGCCGGGCATTGTGGTGGG - Intergenic
959488870 3:106962723-106962745 TTTTTGAACTGCATAGTGTTAGG - Intergenic
959829671 3:110845443-110845465 TCATTGATGGGCATTGCGGTTGG - Intergenic
960129987 3:114045518-114045540 ATTTAGCAGGGCATGGTGGTGGG - Intronic
960220954 3:115107735-115107757 TTATTGATGGGCATTTTGGTTGG - Intronic
960777024 3:121268152-121268174 TCATTGAAGGGCATTTCGGTTGG - Intronic
961080452 3:124022536-124022558 TCTTTGATGGGCATTCGGGTTGG + Intergenic
962012646 3:131407996-131408018 TTTTTGAAGGGTTTTTTGGGTGG - Intergenic
962819312 3:139032668-139032690 TTTTTGATGGGGGTTCTGGTAGG + Intronic
962945053 3:140160795-140160817 ATTTTGAAAGCTATTGTGGTAGG - Intronic
963432578 3:145228659-145228681 AATTAGAAGGGCATGGTGGTGGG - Intergenic
963443890 3:145376477-145376499 TGTTTGAAGGGTATTTTTGTTGG - Intergenic
963628733 3:147707232-147707254 TCTTTGATGGGCATTTGGGTTGG + Intergenic
963699983 3:148613318-148613340 TTTTAGGAAGGCAGTGTGGTAGG + Intergenic
963712426 3:148761974-148761996 TTATTGATGGGCATTTGGGTTGG - Intergenic
964179722 3:153868273-153868295 TTATTGATGGGCATTTGGGTTGG + Intergenic
964204920 3:154162952-154162974 TTTTTGAACCGCATGATGGTAGG + Intronic
964443515 3:156737127-156737149 TCATTGATGGGCATTTTGGTTGG - Intergenic
964687315 3:159411123-159411145 GCTTAGAAGGGTATTGTGGTGGG + Intronic
964932093 3:162038336-162038358 TTTTTAAAGTGGATTGTGTTAGG + Intergenic
966283572 3:178265403-178265425 TCATTGATGGGCATTTTGGTTGG + Intergenic
966539133 3:181069727-181069749 TTATTGATGGGCATTTGGGTTGG + Intergenic
966612752 3:181884275-181884297 TTTTTGAACTGCCTGGTGGTAGG - Intergenic
967485873 3:190029851-190029873 AATTAGAAGGGCATGGTGGTGGG + Intronic
967681699 3:192371144-192371166 TGTTTGAAGTGTCTTGTGGTCGG - Intronic
968279923 3:197468678-197468700 TTTTGGTTGGGCATTGGGGTTGG + Intergenic
969131983 4:4996797-4996819 TTATTGATGGGCATTTGGGTTGG + Intergenic
971130171 4:23799607-23799629 TGTTTGATGTGCATTGTAGTAGG - Intronic
971517087 4:27500798-27500820 TTATTGATGGGCATTTGGGTTGG - Intergenic
971642848 4:29157857-29157879 TTTTTCAAGGGTAGTCTGGTGGG + Intergenic
971721535 4:30251291-30251313 TTATTGATGGGCATTTGGGTTGG + Intergenic
971843971 4:31894338-31894360 TTTATGAACTGCATGGTGGTAGG - Intergenic
971913568 4:32828293-32828315 TCTTTCATGGGCATTTTGGTTGG + Intergenic
972192449 4:36611409-36611431 TTTTTGAAGGAGATTTTTGTTGG - Intergenic
972714056 4:41628142-41628164 TTCTTGGAGGGCCTTGTGGGAGG + Intronic
973037756 4:45427599-45427621 TTATTGATGGGCATTTGGGTTGG + Intergenic
973340684 4:49000393-49000415 TTTTTGATAGGCATTGTATTTGG + Intronic
974191021 4:58504181-58504203 TCTTTGATGGGCATTTGGGTTGG - Intergenic
974533533 4:63144783-63144805 TCATTGATGGGCATTTTGGTTGG + Intergenic
974663446 4:64925123-64925145 TTATTGATGGGCATTTAGGTCGG - Intergenic
974765376 4:66337573-66337595 TTTTTGAACTGCATGGTGGCAGG - Intergenic
974978226 4:68918423-68918445 TATTTGAAGTGACTTGTGGTGGG - Intergenic
975064142 4:70040189-70040211 TCATTGATGGGCATTTTGGTTGG + Intergenic
975073339 4:70171610-70171632 TTTTTGAACTGCATGGTGGTAGG - Intronic
975424440 4:74209591-74209613 TTATTGATGGGCATTTGGGTTGG + Intronic
975526037 4:75351506-75351528 TTATTGATGGGCATTTGGGTTGG + Intergenic
975739089 4:77411013-77411035 TGATTGATGGGCATTTTGGTTGG + Intronic
976223591 4:82777961-82777983 TTATTGATGGGCATTTGGGTTGG - Intronic
976585286 4:86790652-86790674 CCTTAGAAGGGCTTTGTGGTAGG + Intronic
976693625 4:87895045-87895067 TTATTGATGGGCATTTTGGTTGG - Intergenic
976736919 4:88319546-88319568 ATTTTGAAGGACATTGTTGAAGG + Intergenic
976960542 4:90966487-90966509 TTTTTGAAAGACAGTTTGGTTGG - Intronic
977106393 4:92890857-92890879 TCATTGATGGGCATTTTGGTTGG - Intronic
977948994 4:102948042-102948064 TTTTTGAACTGCATAGTGGGAGG - Intronic
978285884 4:107076034-107076056 TTATTGATGGGCATTTGGGTTGG - Intronic
978660398 4:111119646-111119668 TCATTGAAGGGCATTTGGGTTGG - Intergenic
978853295 4:113364066-113364088 TTTATGAATGGCATGGTGGGAGG + Intronic
979306103 4:119145483-119145505 TTTTAGCTGGGCATGGTGGTGGG - Intronic
979421894 4:120514852-120514874 TCTTTGATGGGCATTTGGGTTGG - Intergenic
979709690 4:123764375-123764397 TCTTTGATGGGCATTTGGGTTGG + Intergenic
979711930 4:123789910-123789932 TTATTGATGGGCATTTGGGTTGG + Intergenic
979927673 4:126588047-126588069 TCATTGATGGGCATTTTGGTTGG - Intergenic
980311506 4:131136591-131136613 TTTGTGAGGATCATTGTGGTGGG - Intergenic
980414501 4:132467380-132467402 TTATTGATGGGCATTTGGGTTGG - Intergenic
980524045 4:133966549-133966571 TTATTGATGGGCATTTGGGTTGG - Intergenic
980564333 4:134518896-134518918 ATTTTTAAGGGCACTTTGGTGGG - Intergenic
980748436 4:137054576-137054598 TTTTTGCATGTCATTGTGGTGGG - Intergenic
981066771 4:140494128-140494150 TTTTCCATGGGCAGTGTGGTGGG - Intronic
981347170 4:143689625-143689647 TTATTGATGGTCATTTTGGTTGG - Intronic
981505098 4:145491037-145491059 ATTTTGAAGGGCTCTGTGGCTGG - Intronic
981879339 4:149590848-149590870 TTATTGATGGGCATTTGGGTTGG + Intergenic
982237155 4:153262283-153262305 TTTTTCAAGGGTAGTTTGGTGGG + Intronic
982371281 4:154636637-154636659 TTATTGATGGGCATTTGGGTTGG - Intronic
982723154 4:158880187-158880209 TTATTGATGGGCATTTGGGTTGG - Intronic
982846613 4:160260507-160260529 TCTTTGATGGGCATTTGGGTTGG + Intergenic
983848556 4:172549585-172549607 TTTTTAAATTGCATTGTGGTAGG - Intronic
984336143 4:178393779-178393801 TCTTTGATGGGCATTTGGGTTGG + Intergenic
985216737 4:187661305-187661327 TTTTTCAAGGGTAGTTTGGTGGG - Intergenic
985495453 5:202184-202206 CTTTTGAAATGGATTGTGGTCGG - Exonic
986675701 5:10183347-10183369 TCATTGATGGGCATTGGGGTTGG - Intergenic
986902265 5:12451076-12451098 TTATTGATGGGCATTTGGGTTGG - Intergenic
987256981 5:16165112-16165134 TATTTGAAGAGCATTCTGGAAGG - Intronic
987552136 5:19396735-19396757 TTTTTGAAGGATATTGTGTTAGG - Intergenic
987602873 5:20094900-20094922 TCATTGATGGGCATTTTGGTTGG - Intronic
988138412 5:27204094-27204116 TCTTTGATGGGCATTTGGGTAGG - Intergenic
988249570 5:28738706-28738728 TTTTGGAAGGGAATTTTGGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989769840 5:45130733-45130755 TTTTTGAAAGTGATTGTGCTTGG + Intergenic
990064737 5:51698403-51698425 TTATTGATGGGCATTTGGGTTGG + Intergenic
990526253 5:56630322-56630344 TTATTGATGGGCATTTGGGTTGG + Intergenic
990945979 5:61249869-61249891 TTATTGATGGGCATTTAGGTTGG + Intergenic
991025007 5:62019698-62019720 TTTTATAAGGGCACTGTGTTAGG - Intergenic
991056077 5:62322090-62322112 TTTTTAGAGGGGATTGGGGTAGG + Intronic
991081300 5:62603366-62603388 TTTTTGAAGTGCATGGCAGTAGG - Intronic
991110223 5:62891270-62891292 TTATTGATGGGCATTTGGGTTGG + Intergenic
991366188 5:65870684-65870706 TTTTTTAATGACATCGTGGTAGG + Intronic
991997116 5:72399016-72399038 TTTTTGAAGATCTTTGTGTTGGG + Intergenic
992209342 5:74462700-74462722 TTTTTAAAGGGTATTGTTGGTGG - Intergenic
992331609 5:75722687-75722709 TTTTTGCTGGACATTGTGTTAGG + Intergenic
992339609 5:75809186-75809208 TGATTGATGGGCATTTTGGTTGG + Intergenic
993249088 5:85492655-85492677 TCATTGATGGGCATTTTGGTTGG + Intergenic
993378207 5:87174852-87174874 TTATTGATGGGCATTTGGGTTGG + Intergenic
993729920 5:91410381-91410403 TTTTTGAACTGCCTGGTGGTAGG - Intergenic
993767980 5:91886361-91886383 ATTTTGAAGGGCAAAGTGGCGGG - Intergenic
994415570 5:99465975-99465997 ATTTTGAATGGCAAAGTGGTTGG + Intergenic
995186141 5:109273055-109273077 TCATTGATGGGCATTTTGGTTGG - Intergenic
995252055 5:110005069-110005091 TTATTGATGGGCATTTGGGTTGG + Intergenic
995263366 5:110131329-110131351 TTATTGATGGGCATTTGGGTTGG + Intergenic
995302699 5:110602885-110602907 TTATTGATGGGCATTTGGGTTGG - Intronic
995437257 5:112150838-112150860 TTTTTGAAAGGGATTTTGCTGGG - Intronic
995472328 5:112515834-112515856 TCTTTGATGGGCATTTGGGTTGG + Intergenic
995864764 5:116679122-116679144 TGATTGAAGGGCATTTGGGTTGG + Intergenic
996156524 5:120109533-120109555 TTCTTGATGGGCATTTGGGTTGG - Intergenic
996327242 5:122288782-122288804 TTTTTGAACTGCATGGTGGTAGG + Intergenic
996899748 5:128531101-128531123 TGATTGAAGGGCATTTGGGTTGG - Intronic
996999716 5:129745242-129745264 TATTGGAAGAGCAGTGTGGTGGG - Intergenic
997855345 5:137368108-137368130 TGTTTGAGGGGGAATGTGGTTGG - Intronic
998603590 5:143610487-143610509 TGATTGATGGGCATTTTGGTTGG - Intergenic
998659640 5:144221663-144221685 TTATTGATGGGCATTTGGGTTGG + Intronic
998732540 5:145096777-145096799 TTATTGATGGGCATTTGGGTTGG + Intergenic
998906364 5:146909346-146909368 TCTTTGAAGTGTATTGGGGTTGG - Intronic
999024988 5:148218869-148218891 TTGTTGATGGGCATTTGGGTTGG - Intergenic
999078670 5:148822696-148822718 TTCTTGATGGGCATTTGGGTTGG + Intergenic
999510048 5:152240709-152240731 TCATTGATGGGCATTTTGGTTGG - Intergenic
1000283717 5:159807254-159807276 TCATTGATGGGCATTTTGGTTGG - Intergenic
1000737945 5:164928847-164928869 TTATTGATGGGCATTTGGGTTGG + Intergenic
1000790647 5:165602881-165602903 TTTTTGAACTGCATGGTGGGAGG + Intergenic
1000879066 5:166676233-166676255 TTTTTGAAGTTCATTGTTCTTGG - Intergenic
1000964319 5:167637564-167637586 TCATTGATGGGCATTGGGGTTGG - Intronic
1001011218 5:168100478-168100500 TTATTGATGGGCATTTGGGTTGG - Intronic
1001725644 5:173895995-173896017 TTTTTGAAAGTCATCGTTGTTGG + Intronic
1002209216 5:177586108-177586130 TTATTGATGGGCATTTGGGTTGG + Intergenic
1002804706 6:561732-561754 ATTTTGCTGGGCATGGTGGTGGG - Intronic
1003104479 6:3204767-3204789 TTTTTGAAGACCATTGTGACTGG - Intergenic
1004464673 6:15873470-15873492 TTTTTGATGGGCTTTTTGATGGG - Intergenic
1004674359 6:17826912-17826934 TTTTTTCTGGGCATGGTGGTGGG + Intronic
1004783530 6:18939708-18939730 TTCATGAAAGGCAGTGTGGTTGG + Intergenic
1004949072 6:20647924-20647946 TTTTAGCTGGGCATGGTGGTGGG + Intronic
1005074764 6:21896235-21896257 TCTTCGAAGGGCATTGGGGGCGG + Intergenic
1005780355 6:29185478-29185500 TTATTGATGGGCATTTGGGTTGG + Intergenic
1005791682 6:29309280-29309302 TTATTGATGGGCATTTGGGTTGG + Intergenic
1005895098 6:30171360-30171382 TTTTTTGAGAGCATTGTGCTGGG + Intronic
1005908269 6:30284622-30284644 TTTTGTTAGGACATTGTGGTTGG - Intergenic
1007460715 6:42016826-42016848 CTTTGGAAGGCCATGGTGGTTGG - Intronic
1007819284 6:44548838-44548860 TTATTGAAAGGCAGTGGGGTGGG + Intergenic
1007947744 6:45841079-45841101 TCTTTGATGGGCATTTGGGTTGG + Intergenic
1008350888 6:50488934-50488956 TCATTGATGGGCATTTTGGTTGG - Intergenic
1008416206 6:51243815-51243837 TTATTGATGGGCATTTGGGTTGG - Intergenic
1008525946 6:52406887-52406909 TATTTGAGAGGCATTGAGGTAGG + Exonic
1008719645 6:54333212-54333234 TTATTGATGGGCATTTGGGTTGG - Intronic
1009302915 6:62050034-62050056 TTATTGATGGGCATTTGGGTTGG - Intronic
1009661700 6:66620757-66620779 TCATTGATGGGCATTTTGGTTGG + Intergenic
1009696914 6:67117753-67117775 TTATTGATGGGCATTAGGGTTGG + Intergenic
1009708267 6:67284115-67284137 TCTTTGATGGGCATTTGGGTTGG - Intergenic
1009724202 6:67515381-67515403 TTATTGATGGGCATTTGGGTTGG - Intergenic
1009958987 6:70496034-70496056 TTGTTGATGGGCATTTGGGTTGG + Intronic
1010467532 6:76186508-76186530 TTATTGATGGGCATTTGGGTTGG + Intergenic
1011348549 6:86398324-86398346 TTTTTGATGGACATTTGGGTTGG - Intergenic
1011393577 6:86881330-86881352 TTGTTGATGGGCATTTGGGTTGG + Intergenic
1011740359 6:90353528-90353550 TTAGAGAAGGGCATGGTGGTGGG - Intergenic
1011838202 6:91460077-91460099 TTATTGAAGAGAATTGTTGTGGG - Intergenic
1011865781 6:91825290-91825312 TCATTGATGGGCATTTTGGTTGG - Intergenic
1011988150 6:93476049-93476071 TTATTGATGGGCATTTAGGTTGG - Intergenic
1012029588 6:94041301-94041323 CTTTTGATGGGCATTTAGGTTGG + Intergenic
1012989535 6:105911211-105911233 GGTCTGAAGGGCATTGTGGCTGG - Intergenic
1013494230 6:110682112-110682134 TTTTTCAAGGGCATTCTGAATGG + Intronic
1013657181 6:112258178-112258200 TTTTTGAATTGCATGGTGGTAGG - Intergenic
1014027199 6:116662592-116662614 ATTTCTGAGGGCATTGTGGTAGG - Intronic
1014185156 6:118426759-118426781 TTATTGAAGGGGATTTGGGTTGG - Intergenic
1014245995 6:119069181-119069203 TTTATGAAAGACATTGTGCTTGG - Intronic
1014372503 6:120628299-120628321 TTTCTGAAGGGCAATTTTGTTGG - Intergenic
1014628272 6:123756844-123756866 TTTTGGGAGGGCATGGTGGGTGG - Intergenic
1014836017 6:126161478-126161500 TTATTGATGGGCATTTGGGTTGG + Intergenic
1014984549 6:127986899-127986921 TTTGTGTAGGGTATTGTGCTAGG - Intronic
1015670080 6:135678581-135678603 TTGTTGATGGGCATTTGGGTTGG + Intergenic
1015738505 6:136427312-136427334 TTTTTGAAGGTCATTTTGCAGGG + Intronic
1016068452 6:139708336-139708358 TTTTGGAATGGGATGGTGGTAGG + Intergenic
1016138999 6:140585232-140585254 TTTTGGAAGGTCAGTGTGGGTGG + Intergenic
1016522413 6:144961677-144961699 TTTTTGAGGGGAATGGTGGCAGG + Intergenic
1016734491 6:147461884-147461906 TCTTTGATGGGCATTTGGGTTGG - Intergenic
1016951235 6:149582518-149582540 TTTTTGAACATCATGGTGGTTGG + Exonic
1017200475 6:151748489-151748511 CTAATGAAGGGCATTTTGGTTGG + Intronic
1017442600 6:154477808-154477830 TGTTTGAAGAGCAGTGTGGATGG - Intronic
1018452323 6:163920537-163920559 TTTGTGTAGGGCACTGTGCTAGG + Intergenic
1019801483 7:3091422-3091444 TTTCTGCAGGGCCATGTGGTGGG - Intergenic
1021178720 7:17481234-17481256 ATTTTGAAGGACATGCTGGTAGG - Intergenic
1021185852 7:17564033-17564055 TTATTGATGGGCATTTGGGTTGG - Intergenic
1021476429 7:21066815-21066837 TTTTTCAATGATATTGTGGTAGG - Intergenic
1022411570 7:30142436-30142458 TATTTGAAGGGGGTTGTGGGTGG - Intronic
1022503678 7:30897631-30897653 AGTTTGAAGGGCACGGTGGTGGG - Intergenic
1022720536 7:32938397-32938419 TTTTTAAAGAGCTGTGTGGTCGG + Intergenic
1023085759 7:36568676-36568698 TTTCTGAAGGGGATTGAGGAGGG - Intronic
1023527493 7:41119794-41119816 TGATTGATGGGCATTTTGGTTGG + Intergenic
1023784179 7:43689515-43689537 TTTTTGAAGGTATTTGTGGCTGG - Intronic
1024714349 7:52057994-52058016 TTATTGATGGGCATTTGGGTTGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026656072 7:72257704-72257726 TGGTTGATGGGCATTGAGGTCGG - Intronic
1026670252 7:72384043-72384065 TTATTGATGGGCATTTGGGTTGG - Intronic
1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG + Intronic
1027388516 7:77682047-77682069 CTTTTTAAAGCCATTGTGGTGGG - Intergenic
1027511630 7:79089548-79089570 TTTTTGATGGACATTTGGGTCGG - Intronic
1028091339 7:86706506-86706528 TTTATGAAAGGCTTTGTGGTGGG + Intronic
1028161151 7:87485904-87485926 TTATTGATGGGCATTTGGGTTGG - Intergenic
1028186864 7:87796696-87796718 TTTTTGAAGGGCAGTTTTGCTGG - Intronic
1028429430 7:90730252-90730274 TCTTTGATGGGCATTTGGGTTGG + Intronic
1028641668 7:93049035-93049057 TTTTTGAAGGATATTTTAGTTGG - Intergenic
1028678126 7:93491995-93492017 TCTTTGATGGGCATTTGGGTTGG - Intronic
1028997297 7:97115544-97115566 TATTTGTATGGCACTGTGGTGGG + Intergenic
1029128615 7:98312951-98312973 TTTCTGAAGAGCACTCTGGTTGG + Intronic
1030202407 7:106918739-106918761 TTTATGAGGGGCCTTTTGGTTGG + Intergenic
1030331237 7:108273144-108273166 TTATTGATGGGCATTTGGGTTGG + Intronic
1030657512 7:112184223-112184245 TTTGTGCCAGGCATTGTGGTAGG - Intronic
1030697499 7:112602218-112602240 TTATTGATGGGCATTTGGGTTGG - Intergenic
1030717637 7:112828847-112828869 TTTTTGAAAGACATTTTGGCTGG + Intronic
1030779911 7:113587581-113587603 CATTTGAAGGGCTTTGGGGTAGG - Intergenic
1030933697 7:115557579-115557601 TCATTGATGGGCATTTTGGTTGG + Intergenic
1031017135 7:116587308-116587330 TTATTGATGGGCATTTGGGTTGG - Intergenic
1031032594 7:116751166-116751188 TCTTTGATGGGCATTTGGGTTGG - Intronic
1031129225 7:117811996-117812018 TTTTTGAAGGCTGTTGTAGTTGG - Intronic
1031374293 7:121005326-121005348 TCTTTGATGGGCATTTGGGTTGG + Intronic
1031447388 7:121872275-121872297 TTTTTTAAGGCCATTTTGCTAGG + Intergenic
1031742307 7:125449714-125449736 TATTAGAAGGGCATTTTGTTGGG + Intergenic
1032449303 7:132015845-132015867 TGTTTGATGGGCATTTGGGTTGG - Intergenic
1033571731 7:142636222-142636244 TCATTGATGGGCATTTTGGTTGG - Intergenic
1033613993 7:142993719-142993741 TCATTGATGGGCATTGGGGTTGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034779339 7:153863331-153863353 TCATTGATGGGCATTGGGGTTGG + Intergenic
1035579246 8:729663-729685 TTGTTTAAGGACATTGTGGTTGG - Intronic
1035827845 8:2663555-2663577 TTATTGATGGGCATTTGGGTTGG + Intergenic
1035919571 8:3662436-3662458 TTATTGATGGGCATTTGGGTTGG + Intronic
1036554284 8:9844379-9844401 TTATTGATGGGCATTTGGGTTGG - Intergenic
1037376573 8:18236373-18236395 TTCTTGATGGGCATTTGGGTTGG + Intergenic
1037596131 8:20355637-20355659 TTATTGATGGGCATTTGGGTTGG + Intergenic
1037653797 8:20865834-20865856 TTCTTGAAGGTCAGTATGGTGGG + Intergenic
1038061363 8:23917225-23917247 TGATTGAAGGGCATTTGGGTTGG + Intergenic
1038171938 8:25143021-25143043 TATTAGCTGGGCATTGTGGTGGG + Intergenic
1038448361 8:27620332-27620354 TGTTTGAAGGGCTTTCTTGTGGG - Intergenic
1039134363 8:34303306-34303328 TCATTGATGGGCATTTTGGTTGG - Intergenic
1039265705 8:35821721-35821743 TTATTGATGGGCATTTGGGTTGG - Intergenic
1039287931 8:36062716-36062738 TTTTTCAAGGACAGTTTGGTGGG - Intergenic
1039453332 8:37693059-37693081 TTTATGGAGGGCGATGTGGTTGG - Intergenic
1039717943 8:40131434-40131456 TTTTTCAAGTGATTTGTGGTTGG - Intergenic
1039808535 8:41024265-41024287 TTTTTGATGGACATTTAGGTTGG + Intergenic
1039830887 8:41213479-41213501 TTATTGATGGGCATTTGGGTTGG - Intergenic
1040678018 8:49774809-49774831 TCTTTGATGGGCATTTGGGTTGG - Intergenic
1040943953 8:52862160-52862182 TTGTTGATGGGCATTTAGGTTGG + Intergenic
1041133657 8:54732485-54732507 TATTTGCTGGGCATTGTGTTGGG - Intergenic
1041155483 8:54981420-54981442 TTATTGATGGGCATTTGGGTTGG - Intergenic
1041193840 8:55380336-55380358 TTTTTGAAGGGGGTTATGATAGG - Intronic
1041837932 8:62237921-62237943 TCATTGAAGGGCATTTGGGTTGG + Intergenic
1042179493 8:66071793-66071815 TTATTGATGGACATTTTGGTTGG - Intronic
1042644467 8:70970712-70970734 TTATTGATGGACATTTTGGTTGG + Intergenic
1043176153 8:77025739-77025761 TTATTGATGGGCATTTGGGTTGG - Intergenic
1043223362 8:77694114-77694136 TCTTTGATGGGCATTTGGGTTGG + Intergenic
1043686699 8:83095593-83095615 TTATTGATGGGCATTTGGGTTGG - Intergenic
1043814659 8:84787418-84787440 TTACTGAAGGGCATTTGGGTTGG + Intronic
1044063125 8:87664027-87664049 TTTGTGCAGGCCAATGTGGTGGG - Intergenic
1044168700 8:89022135-89022157 TGATTGATGGGCATTTTGGTTGG + Intergenic
1044253720 8:90034964-90034986 TTTTTGAAGGGTATTTTTGATGG + Intronic
1044326695 8:90866996-90867018 TTATTGATGGGCATTTGGGTTGG - Intronic
1044355738 8:91220749-91220771 TCATTGATGGGCATTTTGGTTGG + Intronic
1044495342 8:92871766-92871788 TTAATGAATGTCATTGTGGTAGG - Intergenic
1044497965 8:92913713-92913735 TCATTGATGGGCATTGGGGTTGG - Intronic
1044501983 8:92968198-92968220 TTATTGATGGGCATTTGGGTTGG + Intronic
1044594654 8:93946984-93947006 TTATTGATGGGCATTTAGGTTGG + Intergenic
1044622559 8:94204543-94204565 TCATTGATGGGCATTTTGGTTGG + Intronic
1044738617 8:95303406-95303428 TTTTTGTGGGGCATGGTGGGGGG + Intergenic
1044876833 8:96677071-96677093 TGTTTGATGGGCACTTTGGTTGG + Intronic
1046150180 8:110213181-110213203 TTCTTGAAGGGTATTTTTGTTGG - Intergenic
1046245541 8:111556085-111556107 TCTTTGATGGGCATTTAGGTTGG + Intergenic
1046781263 8:118217807-118217829 TTTGTGAAGGGCATTATGGAGGG - Intronic
1046838493 8:118829961-118829983 TTATTGATGGGCATTTGGGTTGG - Intergenic
1046856135 8:119033985-119034007 TTATTGATGGGCATTTGGGTTGG - Intronic
1046980788 8:120334369-120334391 ATTTTGAATGACATTGTAGTTGG - Intronic
1047061384 8:121230598-121230620 TTATTGATGGGCATTTGGGTTGG + Intergenic
1047300698 8:123611466-123611488 TTATTGATGGGCATTTGGGTTGG + Intergenic
1048587197 8:135785246-135785268 TCATTGAAGGGCATTTGGGTTGG + Intergenic
1048688418 8:136930496-136930518 TTTTTCAAGGACAGTTTGGTGGG - Intergenic
1048925758 8:139269839-139269861 TGGTTGATGGGCATTGGGGTTGG - Intergenic
1049449657 8:142653838-142653860 TTTTTCAAGGACAGTTTGGTGGG - Intergenic
1049937445 9:512995-513017 TTGTTGAAGGGTATGGTGTTGGG + Intronic
1050009081 9:1167662-1167684 TTTTTGAAGGATATTTTGCTGGG + Intergenic
1050032272 9:1399095-1399117 TCATTGAAGGGCATTTGGGTTGG - Intergenic
1050491656 9:6195094-6195116 TTTTTTAAGGGCAATTTGGCCGG + Intergenic
1050597807 9:7221719-7221741 TTATTGAAGGACATTTGGGTTGG - Intergenic
1050656670 9:7836123-7836145 TCATTGATGGGCATTTTGGTTGG + Intronic
1051045232 9:12865208-12865230 TCATTGATGGGCATTTTGGTTGG + Intergenic
1051207886 9:14708715-14708737 TTATTGATGGGCATTCGGGTTGG - Intergenic
1051491318 9:17669657-17669679 TTTTTGAAGGACACCGGGGTTGG + Intronic
1051825593 9:21214891-21214913 TTATTGATGGGCATTTGGGTTGG + Intronic
1052247429 9:26353057-26353079 TGATTGATGGGCATTTTGGTTGG - Intergenic
1052295801 9:26895046-26895068 GTTTTTAAGGGAATTTTGGTGGG - Intergenic
1052316084 9:27117731-27117753 GGTTTGAAGGGCATCGTGGGCGG + Intronic
1052429314 9:28346435-28346457 TTATTGATGGGCATTTGGGTTGG + Intronic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1052783831 9:32810373-32810395 TTATTGAAGGACATCTTGGTTGG - Intergenic
1053029424 9:34761590-34761612 TTTTTTAAAGACTTTGTGGTTGG + Intergenic
1053467753 9:38322869-38322891 TCATTGATGGGCATTTTGGTTGG + Intergenic
1053585478 9:39453519-39453541 TTTATGAATGGGATTGTGTTTGG + Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054580835 9:66911707-66911729 TTTATGAATGGGATTGTGTTTGG - Intronic
1054844054 9:69773759-69773781 TTGTTGATGGGCATTAGGGTTGG - Intergenic
1054889872 9:70239736-70239758 TTATTGATGGGCATTTGGGTTGG - Intergenic
1056244805 9:84683587-84683609 TCATTGATGGGCATTTTGGTTGG + Intronic
1057268297 9:93633188-93633210 TTTTTGAAAGCCACAGTGGTGGG + Intronic
1057342558 9:94215833-94215855 TTTTTGAACTGCATGGTCGTAGG + Intergenic
1058226119 9:102365910-102365932 TTATTGATGGGCATTTGGGTTGG - Intergenic
1058374877 9:104311014-104311036 TTATTGATGGGCATTTGGGTTGG - Intergenic
1058511933 9:105728485-105728507 TTATTGATGGACATTTTGGTTGG + Intronic
1058558537 9:106198745-106198767 TCATTGATGGGCATTTTGGTTGG + Intergenic
1058994828 9:110289342-110289364 AGTTTGAAAGTCATTGTGGTAGG - Intergenic
1059113068 9:111575151-111575173 AATTAGAAGGGCATGGTGGTGGG + Intronic
1059789793 9:117628717-117628739 TTTTTGAATGGCATGGTGAGGGG - Intergenic
1059921902 9:119169073-119169095 TCATTGATGGGCATTTTGGTTGG - Intronic
1060029217 9:120199811-120199833 TCTCTGATGGGCATTTTGGTTGG + Intergenic
1060649916 9:125316636-125316658 TTGTTGATGGGCATTTGGGTTGG + Intronic
1061161068 9:128894333-128894355 AATTTGCCGGGCATTGTGGTGGG + Intronic
1062022120 9:134324793-134324815 TTTTAGAAGGGCAGTGGGTTGGG + Intronic
1185489354 X:509083-509105 TTATTGATGGGCATTTGGGTTGG + Intergenic
1185637551 X:1564197-1564219 TTATTGATGGGCATTTGGGTTGG - Intergenic
1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG + Intergenic
1186632876 X:11369141-11369163 TTTTTACAGGACATTGTGGTAGG + Intronic
1187076445 X:15939780-15939802 TTATTGATGGGCATTTGGGTTGG + Intergenic
1187136272 X:16550616-16550638 TTGTTTAAGGGCACTTTGGTGGG + Intergenic
1188710920 X:33396330-33396352 TTACTGAAGGGCATTTGGGTTGG + Intergenic
1189191443 X:39111592-39111614 TTTTTGAAGGACAGTTTTGTTGG + Intergenic
1189455491 X:41184557-41184579 TATTTTAAGAGCATTGAGGTAGG - Exonic
1189610758 X:42732065-42732087 TTGATAAAGGGAATTGTGGTAGG + Intergenic
1189702088 X:43722087-43722109 TTATTGATGGGCATTTGGGTTGG + Intronic
1190894998 X:54608753-54608775 TTATTGATGGGCATTTGGGTTGG + Intergenic
1191004153 X:55692622-55692644 TCTTTGATGGGCATTTGGGTTGG - Intergenic
1191040213 X:56069995-56070017 TCTTTGATGGGCATTTGGGTTGG - Intergenic
1191920500 X:66251378-66251400 TTTTTAAAGGCCATTGTGACAGG + Intronic
1192045662 X:67670999-67671021 TCATTGATGGGCATTTTGGTTGG + Intronic
1192152863 X:68722858-68722880 TTTTGGAAGGTCATTCTGGCAGG - Intronic
1192361383 X:70442739-70442761 CTTTTGAACTGCATGGTGGTAGG + Intergenic
1192702695 X:73492433-73492455 TCTTTGATGGGCATTTGGGTTGG + Intergenic
1192708233 X:73550673-73550695 TCATTGAAGGGCATTTGGGTTGG - Intergenic
1193195485 X:78626507-78626529 TTATTGATGGGCATTTGGGTTGG + Intergenic
1193566380 X:83082126-83082148 TCATTGATGGGCATTTTGGTTGG - Intergenic
1193589875 X:83375943-83375965 TTATTGATGGGCATTTGGGTTGG + Intergenic
1193639135 X:83990275-83990297 TCATTGAAGGGCATTTGGGTTGG - Intergenic
1193768037 X:85555805-85555827 TTATTGATGGGAATTTTGGTTGG + Intergenic
1193784793 X:85747536-85747558 TCTTTGATGGGCATTTGGGTTGG + Intergenic
1193826028 X:86228334-86228356 TGATTGAAGGGCATTTTGGTTGG + Intronic
1194487422 X:94502516-94502538 TCATTGATGGGCATTTTGGTTGG + Intergenic
1194537912 X:95130181-95130203 GTGTAGAAGGGCACTGTGGTTGG - Intergenic
1194601471 X:95926357-95926379 TTATTGATGGACATTTTGGTTGG - Intergenic
1194625297 X:96220255-96220277 TTATTGATGGGCATTTGGGTTGG - Intergenic
1194811777 X:98396419-98396441 TTATTGATGGGCATTTGGGTTGG - Intergenic
1194856542 X:98936304-98936326 TTTTTTTAAGGCATTGTGATAGG - Intergenic
1194968925 X:100321166-100321188 TCTTTGATGGGCATTTGGGTTGG + Intronic
1195034531 X:100960380-100960402 TTTTTGAAGGGCAGTTTTGCTGG - Intergenic
1195602631 X:106766112-106766134 TTATTGAAGGACATTTGGGTTGG + Intronic
1195833250 X:109083729-109083751 TCATTGATGGGCATTTTGGTTGG + Intergenic
1195854475 X:109315266-109315288 TTATTGATGGGCATTTGGGTTGG + Intergenic
1196600964 X:117601508-117601530 TCATTGATGGGCATTTTGGTTGG + Intergenic
1196898328 X:120359652-120359674 TTTTTGAAGTGCATGGAGGAGGG - Intergenic
1197067001 X:122245524-122245546 TTTTTTAAGGACAATTTGGTGGG + Intergenic
1197087082 X:122491358-122491380 TGTTTGATGGGCATTTAGGTTGG + Intergenic
1197194178 X:123681355-123681377 TTATTGAAGGGAAAGGTGGTGGG + Intronic
1197288335 X:124623727-124623749 TTTTTAAAGGGCAATGAGGAAGG - Intronic
1197434805 X:126413850-126413872 TTATTGATGGGCATTTGGGTTGG - Intergenic
1197496947 X:127195966-127195988 TTGTTGATGGGCATTTAGGTTGG - Intergenic
1197518373 X:127465549-127465571 TTTTTGAAATGCATAGTGGAGGG - Intergenic
1198064864 X:133086242-133086264 TTTTTGAACTGCATGGTGGTAGG + Intronic
1198072802 X:133166183-133166205 TTATTGATGGGCATTTTTGTTGG - Intergenic
1198432776 X:136584456-136584478 TTCTTCAAGGGCATTTTGTTGGG + Intergenic
1198519607 X:137439576-137439598 TTGTTGATGGGCATTTGGGTTGG - Intergenic
1199768865 X:150960881-150960903 TTTTTGAAAGGGCCTGTGGTAGG - Intergenic
1200323561 X:155215238-155215260 TTTTTGGAAGGCACTGAGGTGGG + Intronic
1200717266 Y:6562353-6562375 TTGTTGATGGGCATTTAGGTTGG - Intergenic
1200819625 Y:7569245-7569267 TTATTGATGGGCATTTGGGTTGG - Intergenic
1201184326 Y:11384264-11384286 TTTTTGAACTGCATAGTGGGAGG - Intergenic
1201485242 Y:14486952-14486974 TATTAGCAGGGCATGGTGGTAGG + Intergenic
1201866783 Y:18664524-18664546 TTTTTGAAGGGAGGTGTTGTAGG + Intergenic
1201932346 Y:19365035-19365057 TTATTGATGGGCATTTGGGTAGG - Intergenic
1202023140 Y:20489250-20489272 TCTTTGATGGGCATTTGGGTTGG - Intergenic