ID: 1146877465

View in Genome Browser
Species Human (GRCh38)
Location 17:36424966-36424988
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 6, 1: 2, 2: 2, 3: 9, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146877465_1146877469 6 Left 1146877465 17:36424966-36424988 CCTGCACACTCCTCTTAGGAGAG 0: 6
1: 2
2: 2
3: 9
4: 130
Right 1146877469 17:36424995-36425017 AGATGGAGAAATTGCAGTTCAGG 0: 9
1: 1
2: 3
3: 63
4: 452
1146877465_1146877470 10 Left 1146877465 17:36424966-36424988 CCTGCACACTCCTCTTAGGAGAG 0: 6
1: 2
2: 2
3: 9
4: 130
Right 1146877470 17:36424999-36425021 GGAGAAATTGCAGTTCAGGAAGG 0: 8
1: 1
2: 5
3: 23
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146877465 Original CRISPR CTCTCCTAAGAGGAGTGTGC AGG (reversed) Intronic
900031383 1:375374-375396 CTCTCCAGACAGGTGTGTGCAGG - Intergenic
900051934 1:603574-603596 CTCTCCAGACAGGTGTGTGCAGG - Intergenic
904560830 1:31396109-31396131 CTCTCCTACGATGCTTGTGCAGG - Intergenic
907298739 1:53471971-53471993 CTCTCCTCAGAAAAGTGGGCTGG - Intergenic
907403885 1:54241932-54241954 TACTCCTTAGAGGAGTGGGCTGG + Intronic
913112929 1:115672166-115672188 ATCTCCAAAGTGCAGTGTGCAGG - Intronic
913930709 1:124961233-124961255 CTCTCTCAAGAGGAATGTTCAGG + Intergenic
915721741 1:157991010-157991032 CTCTCCTAGGCCGAGTGTGGTGG + Intergenic
916018828 1:160775614-160775636 CTCTCCTCAGTGGGCTGTGCAGG + Intergenic
920827678 1:209436998-209437020 CTCTCCTAAAAGGAAGGTGATGG - Intergenic
921326319 1:213988889-213988911 CTCTCCTGAGAAGAGAGAGCAGG - Intronic
923622181 1:235588150-235588172 CTCTCCGCAGAGGAGAGTTCTGG + Intronic
1062801918 10:387428-387450 CTGTCCACACAGGAGTGTGCTGG - Intronic
1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG + Intronic
1071829500 10:89357459-89357481 CTTTCTTAGGAGGAGTCTGCAGG - Intronic
1075109481 10:119566569-119566591 CACTCCTAATGGGAATGTGCTGG - Intergenic
1076549895 10:131271526-131271548 CTCACCCAAAAGGAGCGTGCTGG + Intronic
1076696572 10:132250094-132250116 CTCTCATGAGAGGAGTTTGATGG - Intronic
1077718519 11:4604696-4604718 CACTGCTAGGAGGAGTTTGCAGG + Intronic
1078480292 11:11669359-11669381 CTCTCCTATTGGGAGTGTGATGG + Intergenic
1078578256 11:12519032-12519054 CACTCCTAGCAGGAGTATGCAGG - Intronic
1078690684 11:13577396-13577418 TTCTCCCAGGAGGAGTGTGGTGG + Intergenic
1083418819 11:62542344-62542366 CTCTCCTAAGGGCAGGGAGCAGG - Intronic
1086013342 11:82133028-82133050 GTCTCATAACAGGAGTATGCTGG + Intergenic
1090003677 11:122982129-122982151 CTCTGTAAAGAGGAGTTTGCCGG - Intergenic
1090018698 11:123108204-123108226 CTCTCATAAAAGGAGTGGACTGG - Intronic
1091409179 12:228017-228039 CTCTCCTATGACCAGTGTGGAGG + Intronic
1097208239 12:57342586-57342608 CTATCCTCAGAGCAGTGTGGAGG - Intronic
1099276273 12:80580051-80580073 CTCTCCTGATAGGATTGTGAAGG - Intronic
1103527394 12:121577923-121577945 CTCTCCTACTAGGAGGGTGGTGG - Intronic
1104276149 12:127329687-127329709 CTCTGCTAATAGGACAGTGCTGG + Intergenic
1104515958 12:129426909-129426931 CTCTCATAGGTGGAATGTGCAGG + Intronic
1108611225 13:52085594-52085616 CTCTCCTAGGAGAAGCTTGCAGG - Intronic
1113109090 13:106802780-106802802 CTCTCCTGAGAGGACTTTTCTGG - Intergenic
1115201872 14:30862339-30862361 CTCTGAGAGGAGGAGTGTGCAGG + Intergenic
1116516268 14:45810328-45810350 CTCTCCTCAGAGGCATCTGCAGG - Intergenic
1117015972 14:51517280-51517302 CTCTCCCCTGAGGAGTTTGCTGG + Intronic
1117938256 14:60932509-60932531 CTGTCTTACGTGGAGTGTGCAGG + Intronic
1120027446 14:79602278-79602300 GTCTCCTAACAAGATTGTGCAGG + Intronic
1122873530 14:104652185-104652207 GCCTCCTAAGGGGAGAGTGCTGG - Intergenic
1124516379 15:30370285-30370307 CTCTACTGAAAGCAGTGTGCTGG + Intronic
1124726539 15:32160446-32160468 CTCTACTGAAAGCAGTGTGCTGG - Intronic
1128773195 15:70298728-70298750 CTCTTCTTAAAGTAGTGTGCAGG + Intergenic
1128896295 15:71376970-71376992 CTCACCTAGCAGGTGTGTGCAGG + Intronic
1130823570 15:87520191-87520213 TTCTGCTAAGAGGATTGTCCTGG - Intergenic
1130985468 15:88842037-88842059 CTCTCCAAAGTGGAGTGCGAGGG - Intronic
1131426242 15:92347510-92347532 CTCTCCTTGGAGGAGTGTGATGG + Intergenic
1132875062 16:2133537-2133559 CTCCCCGAGGAGGAGTTTGCAGG + Intronic
1133701103 16:8309883-8309905 CTGTCCTAAGAGGACTGTGTGGG + Intergenic
1134519927 16:14913853-14913875 CTCCCCGAGGAGGAGTTTGCAGG - Intronic
1134554004 16:15152384-15152406 CTCCCCGAGGAGGAGTTTGCAGG + Intergenic
1134707599 16:16312507-16312529 CTCCCCGAGGAGGAGTTTGCAGG - Intergenic
1134959944 16:18399618-18399640 CTCCCCGAGGAGGAGTTTGCAGG + Intergenic
1135072984 16:19368689-19368711 CTCTCCAAAGAGCTCTGTGCTGG - Intergenic
1139184425 16:64788879-64788901 CTCTACTAAGAGGATTCTTCAGG + Intergenic
1139581790 16:67878186-67878208 CTCTCCTGATGGGACTGTGCTGG + Exonic
1141911924 16:87066318-87066340 ATCTACTAAGAGGAGTGTGCGGG + Intergenic
1142168439 16:88606486-88606508 CTCTGACAAGAGGACTGTGCCGG - Intronic
1144424220 17:15126146-15126168 CTCTTCTAATAGATGTGTGCTGG - Intergenic
1144815023 17:18028020-18028042 CTCTCCTAGGAACACTGTGCTGG - Intronic
1145811565 17:27767395-27767417 TTCTCCCAGGAGGAGTGTCCAGG + Intronic
1146841894 17:36162033-36162055 TTCTCCTAAGAGGAGTGTGCAGG - Intergenic
1146854205 17:36249993-36250015 CTCTCCTAAGAGGAGTGTGCAGG - Intronic
1146870108 17:36373885-36373907 CTCTCCTAAGAGGAGTGTGCAGG - Intronic
1146877465 17:36424966-36424988 CTCTCCTAAGAGGAGTGTGCAGG - Intronic
1147072989 17:37974509-37974531 CTCTCCTAAGAGGAGTGTGCAGG - Intergenic
1147084511 17:38054047-38054069 CTCTCCTAAGAGGAGTGTGCAGG - Intronic
1147100458 17:38178013-38178035 CTCTCCTAAGAGGAGTGTGCAGG - Intergenic
1147521935 17:41181687-41181709 CTCTCCTAGGAGGAGCATGTAGG - Intergenic
1148135830 17:45291029-45291051 CTCTCCTAGAGGGAGTGGGCTGG - Intronic
1150083399 17:62261059-62261081 TTCTCCTAAGAGGAGTGTGCAGG - Intergenic
1152424046 17:80209419-80209441 CTCTCCTTCGAGGGGTGTCCAGG + Exonic
1152797679 17:82316127-82316149 CTCTCCTGAGAGCAGCGTGGGGG - Intronic
1152948270 17:83210339-83210361 CTCTCCAGACAGGTGTGTGCAGG + Intergenic
1154381242 18:13851950-13851972 TTCTCCTAAGAGAAGAGTCCAGG - Intergenic
1161210060 19:3061643-3061665 CTCCCCCAAGAGGACTTTGCAGG - Intronic
1162916084 19:13875065-13875087 CTCTCCAAAGAGGAGTGGTTGGG - Intronic
1167587597 19:50383803-50383825 TTATCCTAAGAGTAGTGTACCGG + Intergenic
925362715 2:3290635-3290657 CTCTCTAAAGAGGAGGGTGCTGG + Intronic
925847104 2:8044143-8044165 CTCACCTCAGAGGCATGTGCTGG + Intergenic
927450544 2:23205906-23205928 CCCATCTCAGAGGAGTGTGCAGG - Intergenic
929620930 2:43353362-43353384 CTATCCTAAGAGGAGTGAGGTGG + Intronic
929878305 2:45815155-45815177 ATCTCATAAGAGGATTATGCAGG + Intronic
931068309 2:58613165-58613187 CTCTCCACAGAGGAGTGGGAAGG - Intergenic
932165936 2:69507088-69507110 CCCTCCTTGGAGGAGTGTGATGG - Intronic
937102504 2:119282664-119282686 CCCTCCTAAGAGGATTAAGCGGG + Intergenic
937971059 2:127549807-127549829 CACACATAAGGGGAGTGTGCAGG + Intronic
941316570 2:164000369-164000391 CACACATAAGAGGAATGTGCTGG + Intergenic
942981670 2:182091507-182091529 CACTAGTAAGAGGAATGTGCAGG + Intronic
943738250 2:191381317-191381339 CTGTCCTAGGAGCCGTGTGCTGG + Intronic
945243416 2:207697371-207697393 GTCTCCCAAGAGGAGCATGCTGG + Intergenic
946441951 2:219704225-219704247 ATCTCCTAGGAGGGGTGTCCTGG + Intergenic
948836745 2:240629559-240629581 CCCTGCTAAGAGCTGTGTGCTGG + Intronic
1168761067 20:349734-349756 CTCTTCTATGAGGACTGTGCAGG + Exonic
1170205358 20:13792175-13792197 CACCCCTCACAGGAGTGTGCTGG + Intronic
1175391571 20:58631002-58631024 CTCTCCAAAGGGGAGTGGGCTGG + Intergenic
1175789393 20:61731943-61731965 ATCTCCTAAGGGGAGTGGGTGGG - Intronic
1177264534 21:18765419-18765441 CTCTCCTCAGAGGTTTGAGCAGG + Intergenic
1181688753 22:24546563-24546585 ATGGCCTAAGAGGAATGTGCTGG - Intronic
1181850887 22:25749241-25749263 CTCTCCCAAGAAATGTGTGCAGG + Intronic
1183026628 22:35070309-35070331 CTCTCCTTGGAGGAGAGAGCAGG - Intronic
950136785 3:10586701-10586723 CTCTCCTCAGAGGGGTGAGAGGG + Intronic
953579865 3:44144183-44144205 CTCTCTTGGGAGGATTGTGCAGG + Intergenic
958111230 3:89148712-89148734 CTTTCCTAAGATGGGTATGCTGG - Intronic
959682341 3:109109746-109109768 CTCTCCTAGGAGGAAAATGCAGG - Intronic
961671448 3:128534624-128534646 AGTTCCTAAGAGGAGTCTGCAGG + Intergenic
963835587 3:150055235-150055257 TTCACCTAAGAGGAGTGTGTAGG + Intergenic
967892706 3:194374291-194374313 CTCTCATAACAGGACTGTGTTGG + Intergenic
969376614 4:6767644-6767666 CTCACCTAAAAGGAATGTGCCGG - Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
977785861 4:101034209-101034231 CGCCCCTCAGTGGAGTGTGCTGG - Intronic
979103412 4:116652830-116652852 CTCTCCTTGGAGGATTGGGCTGG + Intergenic
988029110 5:25739419-25739441 GGCTCCTAAGAGGTTTGTGCTGG - Intergenic
988631436 5:32935784-32935806 CTCTCCGAAGAGGACTGGCCAGG + Intergenic
988913457 5:35869263-35869285 CTCTGCTAAGAGAAGTGGGAAGG - Intronic
992210330 5:74473181-74473203 CTCTCATGCAAGGAGTGTGCTGG - Intergenic
1000879500 5:166680992-166681014 CTCTCTTAAGAGGTGGGAGCAGG - Intergenic
1001750817 5:174129803-174129825 CACACCTAAGTGGACTGTGCCGG + Intronic
1002742437 5:181443494-181443516 CTCTCCAGACAGGTGTGTGCAGG + Intergenic
1012983025 6:105849950-105849972 CATTCCTAAGAGGCGAGTGCAGG - Intergenic
1018957586 6:168420438-168420460 CTTTCCTTAGAGGAGGGTGGAGG - Intergenic
1019247573 6:170719233-170719255 CTCTCCAGACAGGTGTGTGCAGG + Intergenic
1019406851 7:888532-888554 CTCTCCTCAGAGGAGCCTGGCGG + Intronic
1023414793 7:39921822-39921844 TTCTACTCAGAGGAGTGTGGAGG - Intergenic
1027708208 7:81562676-81562698 CTCTCCTGGGAAGAATGTGCAGG + Intergenic
1029622758 7:101700142-101700164 CTCCCCTAAGATGAGGGTGATGG - Intergenic
1031215160 7:118881246-118881268 CCCTCCTAAGAAGTGTGTGAAGG + Intergenic
1032074768 7:128831168-128831190 CTGTCCCCAGAGGGGTGTGCAGG - Intronic
1033615748 7:143012556-143012578 CACCCCACAGAGGAGTGTGCAGG - Intergenic
1035500564 8:88703-88725 CTCTCCAGACAGGTGTGTGCAGG - Intergenic
1037133310 8:15432749-15432771 CTCACCTAAGTGGGGTGTGGGGG - Intronic
1037681220 8:21099213-21099235 CCCTCCTAGCAGGAGTGTGCTGG - Intergenic
1037768020 8:21783678-21783700 CTCTCGGAAGAGGAGAGTTCAGG - Intronic
1039135862 8:34322185-34322207 TTCTCCTATGAGGATAGTGCAGG + Intergenic
1044942522 8:97357751-97357773 TTCTCCAAAGAGGAGTGTGCAGG - Intergenic
1046025713 8:108721141-108721163 GTCTCCTATGAGTAATGTGCTGG + Intronic
1048377646 8:133836700-133836722 CTGTTCTAAGAGGGGTGTGGTGG + Intergenic
1051330543 9:16020898-16020920 CTCTGCTAAGAGGAGGCTACTGG + Intronic
1055007507 9:71525426-71525448 CTGTCCTGGGAGCAGTGTGCGGG - Intergenic
1055639825 9:78310998-78311020 CTTTCCTCAGGGGAGTGTTCTGG + Intronic
1058026266 9:100144599-100144621 CTTTCCTAAGAGGAAATTGCTGG + Intronic
1059338875 9:113586219-113586241 CCCTCCAAAGAGGAGTGGCCAGG - Intronic
1061443709 9:130625363-130625385 GTCTCATAAGAGCAGAGTGCGGG + Intronic
1062164100 9:135097429-135097451 CCCTCGTTAGAGGAGTCTGCTGG - Intronic
1203608344 Un_KI270748v1:74713-74735 CTCTCCAGACAGGTGTGTGCAGG + Intergenic
1186969397 X:14823891-14823913 CTCTCCTTATTGGAGTGTGTAGG - Intergenic
1192325388 X:70127914-70127936 CTCCCCTAATAGGTGTGTGATGG - Intergenic
1193742298 X:85232088-85232110 CTCTCCTAAGGTGGGTGAGCTGG - Intergenic
1195474297 X:105266625-105266647 CTCTCCTGATAGGAATGTGAGGG - Intronic