ID: 1146877784

View in Genome Browser
Species Human (GRCh38)
Location 17:36426918-36426940
Sequence CCCGGCCGAGGGGAGGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 8, 1: 4, 2: 0, 3: 19, 4: 306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146877784_1146877799 27 Left 1146877784 17:36426918-36426940 CCCCACACCTCCCCTCGGCCGGG 0: 8
1: 4
2: 0
3: 19
4: 306
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877784_1146877797 22 Left 1146877784 17:36426918-36426940 CCCCACACCTCCCCTCGGCCGGG 0: 8
1: 4
2: 0
3: 19
4: 306
Right 1146877797 17:36426963-36426985 CCCAGTGCCCAGCACAGGCGTGG 0: 13
1: 2
2: 17
3: 83
4: 562
1146877784_1146877795 17 Left 1146877784 17:36426918-36426940 CCCCACACCTCCCCTCGGCCGGG 0: 8
1: 4
2: 0
3: 19
4: 306
Right 1146877795 17:36426958-36426980 TCTCTCCCAGTGCCCAGCACAGG 0: 13
1: 2
2: 11
3: 76
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146877784 Original CRISPR CCCGGCCGAGGGGAGGTGTG GGG (reversed) Intronic