ID: 1146877786

View in Genome Browser
Species Human (GRCh38)
Location 17:36426919-36426941
Sequence CCCCGGCCGAGGGGAGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 10, 1: 2, 2: 1, 3: 18, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146877786_1146877795 16 Left 1146877786 17:36426919-36426941 CCCACACCTCCCCTCGGCCGGGG 0: 10
1: 2
2: 1
3: 18
4: 189
Right 1146877795 17:36426958-36426980 TCTCTCCCAGTGCCCAGCACAGG 0: 13
1: 2
2: 11
3: 76
4: 406
1146877786_1146877797 21 Left 1146877786 17:36426919-36426941 CCCACACCTCCCCTCGGCCGGGG 0: 10
1: 2
2: 1
3: 18
4: 189
Right 1146877797 17:36426963-36426985 CCCAGTGCCCAGCACAGGCGTGG 0: 13
1: 2
2: 17
3: 83
4: 562
1146877786_1146877799 26 Left 1146877786 17:36426919-36426941 CCCACACCTCCCCTCGGCCGGGG 0: 10
1: 2
2: 1
3: 18
4: 189
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146877786 Original CRISPR CCCCGGCCGAGGGGAGGTGT GGG (reversed) Intronic