ID: 1146877788

View in Genome Browser
Species Human (GRCh38)
Location 17:36426920-36426942
Sequence GCCCCGGCCGAGGGGAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 8, 1: 2, 2: 4, 3: 50, 4: 335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146877788_1146877795 15 Left 1146877788 17:36426920-36426942 CCACACCTCCCCTCGGCCGGGGC 0: 8
1: 2
2: 4
3: 50
4: 335
Right 1146877795 17:36426958-36426980 TCTCTCCCAGTGCCCAGCACAGG 0: 13
1: 2
2: 11
3: 76
4: 406
1146877788_1146877799 25 Left 1146877788 17:36426920-36426942 CCACACCTCCCCTCGGCCGGGGC 0: 8
1: 2
2: 4
3: 50
4: 335
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877788_1146877797 20 Left 1146877788 17:36426920-36426942 CCACACCTCCCCTCGGCCGGGGC 0: 8
1: 2
2: 4
3: 50
4: 335
Right 1146877797 17:36426963-36426985 CCCAGTGCCCAGCACAGGCGTGG 0: 13
1: 2
2: 17
3: 83
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146877788 Original CRISPR GCCCCGGCCGAGGGGAGGTG TGG (reversed) Intronic