ID: 1146877791

View in Genome Browser
Species Human (GRCh38)
Location 17:36426929-36426951
Sequence CACACAGGAGCCCCGGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 9, 1: 3, 2: 0, 3: 10, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146877791_1146877799 16 Left 1146877791 17:36426929-36426951 CCCTCGGCCGGGGCTCCTGTGTG 0: 9
1: 3
2: 0
3: 10
4: 163
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877791_1146877795 6 Left 1146877791 17:36426929-36426951 CCCTCGGCCGGGGCTCCTGTGTG 0: 9
1: 3
2: 0
3: 10
4: 163
Right 1146877795 17:36426958-36426980 TCTCTCCCAGTGCCCAGCACAGG 0: 13
1: 2
2: 11
3: 76
4: 406
1146877791_1146877802 22 Left 1146877791 17:36426929-36426951 CCCTCGGCCGGGGCTCCTGTGTG 0: 9
1: 3
2: 0
3: 10
4: 163
Right 1146877802 17:36426974-36426996 GCACAGGCGTGGAACGGAAGAGG 0: 10
1: 2
2: 1
3: 5
4: 115
1146877791_1146877803 29 Left 1146877791 17:36426929-36426951 CCCTCGGCCGGGGCTCCTGTGTG 0: 9
1: 3
2: 0
3: 10
4: 163
Right 1146877803 17:36426981-36427003 CGTGGAACGGAAGAGGTGAATGG 0: 10
1: 1
2: 2
3: 7
4: 144
1146877791_1146877797 11 Left 1146877791 17:36426929-36426951 CCCTCGGCCGGGGCTCCTGTGTG 0: 9
1: 3
2: 0
3: 10
4: 163
Right 1146877797 17:36426963-36426985 CCCAGTGCCCAGCACAGGCGTGG 0: 13
1: 2
2: 17
3: 83
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146877791 Original CRISPR CACACAGGAGCCCCGGCCGA GGG (reversed) Intronic