ID: 1146877793

View in Genome Browser
Species Human (GRCh38)
Location 17:36426936-36426958
Sequence ACAGATGCACACAGGAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 11, 1: 2, 2: 4, 3: 39, 4: 377}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146877793_1146877803 22 Left 1146877793 17:36426936-36426958 CCGGGGCTCCTGTGTGCATCTGT 0: 11
1: 2
2: 4
3: 39
4: 377
Right 1146877803 17:36426981-36427003 CGTGGAACGGAAGAGGTGAATGG 0: 10
1: 1
2: 2
3: 7
4: 144
1146877793_1146877799 9 Left 1146877793 17:36426936-36426958 CCGGGGCTCCTGTGTGCATCTGT 0: 11
1: 2
2: 4
3: 39
4: 377
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877793_1146877797 4 Left 1146877793 17:36426936-36426958 CCGGGGCTCCTGTGTGCATCTGT 0: 11
1: 2
2: 4
3: 39
4: 377
Right 1146877797 17:36426963-36426985 CCCAGTGCCCAGCACAGGCGTGG 0: 13
1: 2
2: 17
3: 83
4: 562
1146877793_1146877802 15 Left 1146877793 17:36426936-36426958 CCGGGGCTCCTGTGTGCATCTGT 0: 11
1: 2
2: 4
3: 39
4: 377
Right 1146877802 17:36426974-36426996 GCACAGGCGTGGAACGGAAGAGG 0: 10
1: 2
2: 1
3: 5
4: 115
1146877793_1146877795 -1 Left 1146877793 17:36426936-36426958 CCGGGGCTCCTGTGTGCATCTGT 0: 11
1: 2
2: 4
3: 39
4: 377
Right 1146877795 17:36426958-36426980 TCTCTCCCAGTGCCCAGCACAGG 0: 13
1: 2
2: 11
3: 76
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146877793 Original CRISPR ACAGATGCACACAGGAGCCC CGG (reversed) Intronic