ID: 1146877799

View in Genome Browser
Species Human (GRCh38)
Location 17:36426968-36426990
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 12, 1: 1, 2: 0, 3: 20, 4: 157}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146877794_1146877799 1 Left 1146877794 17:36426944-36426966 CCTGTGTGCATCTGTCTCTCCCA 0: 11
1: 1
2: 4
3: 28
4: 326
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877782_1146877799 28 Left 1146877782 17:36426917-36426939 CCCCCACACCTCCCCTCGGCCGG 0: 8
1: 4
2: 2
3: 24
4: 369
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877792_1146877799 15 Left 1146877792 17:36426930-36426952 CCTCGGCCGGGGCTCCTGTGTGC 0: 9
1: 3
2: 3
3: 25
4: 196
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877793_1146877799 9 Left 1146877793 17:36426936-36426958 CCGGGGCTCCTGTGTGCATCTGT 0: 11
1: 2
2: 4
3: 39
4: 377
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877781_1146877799 29 Left 1146877781 17:36426916-36426938 CCCCCCACACCTCCCCTCGGCCG 0: 8
1: 7
2: 2
3: 45
4: 482
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877791_1146877799 16 Left 1146877791 17:36426929-36426951 CCCTCGGCCGGGGCTCCTGTGTG 0: 9
1: 3
2: 0
3: 10
4: 163
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877784_1146877799 27 Left 1146877784 17:36426918-36426940 CCCCACACCTCCCCTCGGCCGGG 0: 8
1: 4
2: 0
3: 19
4: 306
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877786_1146877799 26 Left 1146877786 17:36426919-36426941 CCCACACCTCCCCTCGGCCGGGG 0: 10
1: 2
2: 1
3: 18
4: 189
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877790_1146877799 17 Left 1146877790 17:36426928-36426950 CCCCTCGGCCGGGGCTCCTGTGT 0: 9
1: 3
2: 2
3: 7
4: 129
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877788_1146877799 25 Left 1146877788 17:36426920-36426942 CCACACCTCCCCTCGGCCGGGGC 0: 8
1: 2
2: 4
3: 50
4: 335
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157
1146877789_1146877799 20 Left 1146877789 17:36426925-36426947 CCTCCCCTCGGCCGGGGCTCCTG 0: 10
1: 2
2: 2
3: 27
4: 356
Right 1146877799 17:36426968-36426990 TGCCCAGCACAGGCGTGGAACGG 0: 12
1: 1
2: 0
3: 20
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type