ID: 1146877802

View in Genome Browser
Species Human (GRCh38)
Location 17:36426974-36426996
Sequence GCACAGGCGTGGAACGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 10, 1: 2, 2: 1, 3: 5, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146877790_1146877802 23 Left 1146877790 17:36426928-36426950 CCCCTCGGCCGGGGCTCCTGTGT 0: 9
1: 3
2: 2
3: 7
4: 129
Right 1146877802 17:36426974-36426996 GCACAGGCGTGGAACGGAAGAGG 0: 10
1: 2
2: 1
3: 5
4: 115
1146877789_1146877802 26 Left 1146877789 17:36426925-36426947 CCTCCCCTCGGCCGGGGCTCCTG 0: 10
1: 2
2: 2
3: 27
4: 356
Right 1146877802 17:36426974-36426996 GCACAGGCGTGGAACGGAAGAGG 0: 10
1: 2
2: 1
3: 5
4: 115
1146877791_1146877802 22 Left 1146877791 17:36426929-36426951 CCCTCGGCCGGGGCTCCTGTGTG 0: 9
1: 3
2: 0
3: 10
4: 163
Right 1146877802 17:36426974-36426996 GCACAGGCGTGGAACGGAAGAGG 0: 10
1: 2
2: 1
3: 5
4: 115
1146877793_1146877802 15 Left 1146877793 17:36426936-36426958 CCGGGGCTCCTGTGTGCATCTGT 0: 11
1: 2
2: 4
3: 39
4: 377
Right 1146877802 17:36426974-36426996 GCACAGGCGTGGAACGGAAGAGG 0: 10
1: 2
2: 1
3: 5
4: 115
1146877794_1146877802 7 Left 1146877794 17:36426944-36426966 CCTGTGTGCATCTGTCTCTCCCA 0: 11
1: 1
2: 4
3: 28
4: 326
Right 1146877802 17:36426974-36426996 GCACAGGCGTGGAACGGAAGAGG 0: 10
1: 2
2: 1
3: 5
4: 115
1146877792_1146877802 21 Left 1146877792 17:36426930-36426952 CCTCGGCCGGGGCTCCTGTGTGC 0: 9
1: 3
2: 3
3: 25
4: 196
Right 1146877802 17:36426974-36426996 GCACAGGCGTGGAACGGAAGAGG 0: 10
1: 2
2: 1
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146877802 Original CRISPR GCACAGGCGTGGAACGGAAG AGG Intronic