ID: 1146877803

View in Genome Browser
Species Human (GRCh38)
Location 17:36426981-36427003
Sequence CGTGGAACGGAAGAGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 10, 1: 1, 2: 2, 3: 7, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146877791_1146877803 29 Left 1146877791 17:36426929-36426951 CCCTCGGCCGGGGCTCCTGTGTG 0: 9
1: 3
2: 0
3: 10
4: 163
Right 1146877803 17:36426981-36427003 CGTGGAACGGAAGAGGTGAATGG 0: 10
1: 1
2: 2
3: 7
4: 144
1146877796_1146877803 -5 Left 1146877796 17:36426963-36426985 CCCAGTGCCCAGCACAGGCGTGG 0: 13
1: 2
2: 9
3: 77
4: 414
Right 1146877803 17:36426981-36427003 CGTGGAACGGAAGAGGTGAATGG 0: 10
1: 1
2: 2
3: 7
4: 144
1146877792_1146877803 28 Left 1146877792 17:36426930-36426952 CCTCGGCCGGGGCTCCTGTGTGC 0: 9
1: 3
2: 3
3: 25
4: 196
Right 1146877803 17:36426981-36427003 CGTGGAACGGAAGAGGTGAATGG 0: 10
1: 1
2: 2
3: 7
4: 144
1146877793_1146877803 22 Left 1146877793 17:36426936-36426958 CCGGGGCTCCTGTGTGCATCTGT 0: 11
1: 2
2: 4
3: 39
4: 377
Right 1146877803 17:36426981-36427003 CGTGGAACGGAAGAGGTGAATGG 0: 10
1: 1
2: 2
3: 7
4: 144
1146877790_1146877803 30 Left 1146877790 17:36426928-36426950 CCCCTCGGCCGGGGCTCCTGTGT 0: 9
1: 3
2: 2
3: 7
4: 129
Right 1146877803 17:36426981-36427003 CGTGGAACGGAAGAGGTGAATGG 0: 10
1: 1
2: 2
3: 7
4: 144
1146877798_1146877803 -6 Left 1146877798 17:36426964-36426986 CCAGTGCCCAGCACAGGCGTGGA 0: 12
1: 1
2: 6
3: 36
4: 280
Right 1146877803 17:36426981-36427003 CGTGGAACGGAAGAGGTGAATGG 0: 10
1: 1
2: 2
3: 7
4: 144
1146877794_1146877803 14 Left 1146877794 17:36426944-36426966 CCTGTGTGCATCTGTCTCTCCCA 0: 11
1: 1
2: 4
3: 28
4: 326
Right 1146877803 17:36426981-36427003 CGTGGAACGGAAGAGGTGAATGG 0: 10
1: 1
2: 2
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146877803 Original CRISPR CGTGGAACGGAAGAGGTGAA TGG Intronic