ID: 1146878609

View in Genome Browser
Species Human (GRCh38)
Location 17:36430890-36430912
Sequence GATCCTCTGTTCTGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 14, 1: 5, 2: 2, 3: 15, 4: 255}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146878609_1146878613 7 Left 1146878609 17:36430890-36430912 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146878613 17:36430920-36430942 CAGTGTGAGGAAGCTGCCCTCGG 0: 20
1: 0
2: 2
3: 47
4: 349
1146878609_1146878616 17 Left 1146878609 17:36430890-36430912 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146878616 17:36430930-36430952 AAGCTGCCCTCGGGCCAGTCGGG 0: 14
1: 6
2: 1
3: 6
4: 94
1146878609_1146878614 8 Left 1146878609 17:36430890-36430912 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146878614 17:36430921-36430943 AGTGTGAGGAAGCTGCCCTCGGG 0: 15
1: 7
2: 3
3: 24
4: 202
1146878609_1146878615 16 Left 1146878609 17:36430890-36430912 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146878615 17:36430929-36430951 GAAGCTGCCCTCGGGCCAGTCGG 0: 14
1: 4
2: 3
3: 12
4: 122
1146878609_1146878620 30 Left 1146878609 17:36430890-36430912 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146878620 17:36430943-36430965 GCCAGTCGGGGTCTGACCCCAGG 0: 14
1: 0
2: 2
3: 25
4: 112
1146878609_1146878617 18 Left 1146878609 17:36430890-36430912 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146878617 17:36430931-36430953 AGCTGCCCTCGGGCCAGTCGGGG 0: 14
1: 2
2: 2
3: 9
4: 119
1146878609_1146878612 -6 Left 1146878609 17:36430890-36430912 CCTCTGGGCCAGAACAGAGGATC 0: 14
1: 5
2: 2
3: 15
4: 255
Right 1146878612 17:36430907-36430929 AGGATCATGAGGACAGTGTGAGG 0: 15
1: 6
2: 6
3: 63
4: 768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146878609 Original CRISPR GATCCTCTGTTCTGGCCCAG AGG (reversed) Intronic