ID: 1146882082

View in Genome Browser
Species Human (GRCh38)
Location 17:36450178-36450200
Sequence ACTGAGCCACAACGTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882082_1146882087 10 Left 1146882082 17:36450178-36450200 CCATGCCCACGTTGTGGCTCAGT No data
Right 1146882087 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
1146882082_1146882085 9 Left 1146882082 17:36450178-36450200 CCATGCCCACGTTGTGGCTCAGT No data
Right 1146882085 17:36450210-36450232 GCCGATCTCACCCGCTCCGCAGG No data
1146882082_1146882091 29 Left 1146882082 17:36450178-36450200 CCATGCCCACGTTGTGGCTCAGT No data
Right 1146882091 17:36450230-36450252 AGGGTGTTCAGCCTGCCAGCAGG No data
1146882082_1146882092 30 Left 1146882082 17:36450178-36450200 CCATGCCCACGTTGTGGCTCAGT No data
Right 1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882082 Original CRISPR ACTGAGCCACAACGTGGGCA TGG (reversed) Intergenic
No off target data available for this crispr