ID: 1146882083

View in Genome Browser
Species Human (GRCh38)
Location 17:36450183-36450205
Sequence GCTGCACTGAGCCACAACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882083_1146882093 26 Left 1146882083 17:36450183-36450205 CCCACGTTGTGGCTCAGTGCAGC No data
Right 1146882093 17:36450232-36450254 GGTGTTCAGCCTGCCAGCAGGGG No data
1146882083_1146882087 5 Left 1146882083 17:36450183-36450205 CCCACGTTGTGGCTCAGTGCAGC No data
Right 1146882087 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
1146882083_1146882091 24 Left 1146882083 17:36450183-36450205 CCCACGTTGTGGCTCAGTGCAGC No data
Right 1146882091 17:36450230-36450252 AGGGTGTTCAGCCTGCCAGCAGG No data
1146882083_1146882094 27 Left 1146882083 17:36450183-36450205 CCCACGTTGTGGCTCAGTGCAGC No data
Right 1146882094 17:36450233-36450255 GTGTTCAGCCTGCCAGCAGGGGG No data
1146882083_1146882092 25 Left 1146882083 17:36450183-36450205 CCCACGTTGTGGCTCAGTGCAGC No data
Right 1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG No data
1146882083_1146882085 4 Left 1146882083 17:36450183-36450205 CCCACGTTGTGGCTCAGTGCAGC No data
Right 1146882085 17:36450210-36450232 GCCGATCTCACCCGCTCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882083 Original CRISPR GCTGCACTGAGCCACAACGT GGG (reversed) Intergenic
No off target data available for this crispr