ID: 1146882086

View in Genome Browser
Species Human (GRCh38)
Location 17:36450211-36450233
Sequence CCCTGCGGAGCGGGTGAGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882086_1146882098 16 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882098 17:36450250-36450272 AGGGGGCCAGCTGGTCCTCCTGG No data
1146882086_1146882102 28 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882102 17:36450262-36450284 GGTCCTCCTGGGATATGGCACGG No data
1146882086_1146882096 7 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882096 17:36450241-36450263 CCTGCCAGCAGGGGGCCAGCTGG No data
1146882086_1146882094 -1 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882094 17:36450233-36450255 GTGTTCAGCCTGCCAGCAGGGGG No data
1146882086_1146882092 -3 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG No data
1146882086_1146882091 -4 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882091 17:36450230-36450252 AGGGTGTTCAGCCTGCCAGCAGG No data
1146882086_1146882099 17 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882099 17:36450251-36450273 GGGGGCCAGCTGGTCCTCCTGGG No data
1146882086_1146882101 23 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882101 17:36450257-36450279 CAGCTGGTCCTCCTGGGATATGG No data
1146882086_1146882093 -2 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882093 17:36450232-36450254 GGTGTTCAGCCTGCCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882086 Original CRISPR CCCTGCGGAGCGGGTGAGAT CGG (reversed) Intergenic