ID: 1146882088

View in Genome Browser
Species Human (GRCh38)
Location 17:36450220-36450242
Sequence GGCTGAACACCCTGCGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882088_1146882096 -2 Left 1146882088 17:36450220-36450242 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1146882096 17:36450241-36450263 CCTGCCAGCAGGGGGCCAGCTGG No data
1146882088_1146882102 19 Left 1146882088 17:36450220-36450242 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1146882102 17:36450262-36450284 GGTCCTCCTGGGATATGGCACGG No data
1146882088_1146882101 14 Left 1146882088 17:36450220-36450242 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1146882101 17:36450257-36450279 CAGCTGGTCCTCCTGGGATATGG No data
1146882088_1146882098 7 Left 1146882088 17:36450220-36450242 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1146882098 17:36450250-36450272 AGGGGGCCAGCTGGTCCTCCTGG No data
1146882088_1146882099 8 Left 1146882088 17:36450220-36450242 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1146882099 17:36450251-36450273 GGGGGCCAGCTGGTCCTCCTGGG No data
1146882088_1146882094 -10 Left 1146882088 17:36450220-36450242 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1146882094 17:36450233-36450255 GTGTTCAGCCTGCCAGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882088 Original CRISPR GGCTGAACACCCTGCGGAGC GGG (reversed) Intergenic