ID: 1146882089

View in Genome Browser
Species Human (GRCh38)
Location 17:36450221-36450243
Sequence AGGCTGAACACCCTGCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882089_1146882096 -3 Left 1146882089 17:36450221-36450243 CCGCTCCGCAGGGTGTTCAGCCT No data
Right 1146882096 17:36450241-36450263 CCTGCCAGCAGGGGGCCAGCTGG No data
1146882089_1146882099 7 Left 1146882089 17:36450221-36450243 CCGCTCCGCAGGGTGTTCAGCCT No data
Right 1146882099 17:36450251-36450273 GGGGGCCAGCTGGTCCTCCTGGG No data
1146882089_1146882101 13 Left 1146882089 17:36450221-36450243 CCGCTCCGCAGGGTGTTCAGCCT No data
Right 1146882101 17:36450257-36450279 CAGCTGGTCCTCCTGGGATATGG No data
1146882089_1146882098 6 Left 1146882089 17:36450221-36450243 CCGCTCCGCAGGGTGTTCAGCCT No data
Right 1146882098 17:36450250-36450272 AGGGGGCCAGCTGGTCCTCCTGG No data
1146882089_1146882102 18 Left 1146882089 17:36450221-36450243 CCGCTCCGCAGGGTGTTCAGCCT No data
Right 1146882102 17:36450262-36450284 GGTCCTCCTGGGATATGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882089 Original CRISPR AGGCTGAACACCCTGCGGAG CGG (reversed) Intergenic
No off target data available for this crispr