ID: 1146882091

View in Genome Browser
Species Human (GRCh38)
Location 17:36450230-36450252
Sequence AGGGTGTTCAGCCTGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882083_1146882091 24 Left 1146882083 17:36450183-36450205 CCCACGTTGTGGCTCAGTGCAGC No data
Right 1146882091 17:36450230-36450252 AGGGTGTTCAGCCTGCCAGCAGG No data
1146882084_1146882091 23 Left 1146882084 17:36450184-36450206 CCACGTTGTGGCTCAGTGCAGCG No data
Right 1146882091 17:36450230-36450252 AGGGTGTTCAGCCTGCCAGCAGG No data
1146882082_1146882091 29 Left 1146882082 17:36450178-36450200 CCATGCCCACGTTGTGGCTCAGT No data
Right 1146882091 17:36450230-36450252 AGGGTGTTCAGCCTGCCAGCAGG No data
1146882086_1146882091 -4 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882091 17:36450230-36450252 AGGGTGTTCAGCCTGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882091 Original CRISPR AGGGTGTTCAGCCTGCCAGC AGG Intergenic
No off target data available for this crispr