ID: 1146882092

View in Genome Browser
Species Human (GRCh38)
Location 17:36450231-36450253
Sequence GGGTGTTCAGCCTGCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882082_1146882092 30 Left 1146882082 17:36450178-36450200 CCATGCCCACGTTGTGGCTCAGT No data
Right 1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG No data
1146882083_1146882092 25 Left 1146882083 17:36450183-36450205 CCCACGTTGTGGCTCAGTGCAGC No data
Right 1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG No data
1146882086_1146882092 -3 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG No data
1146882084_1146882092 24 Left 1146882084 17:36450184-36450206 CCACGTTGTGGCTCAGTGCAGCG No data
Right 1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882092 Original CRISPR GGGTGTTCAGCCTGCCAGCA GGG Intergenic
No off target data available for this crispr