ID: 1146882093

View in Genome Browser
Species Human (GRCh38)
Location 17:36450232-36450254
Sequence GGTGTTCAGCCTGCCAGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882086_1146882093 -2 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882093 17:36450232-36450254 GGTGTTCAGCCTGCCAGCAGGGG No data
1146882083_1146882093 26 Left 1146882083 17:36450183-36450205 CCCACGTTGTGGCTCAGTGCAGC No data
Right 1146882093 17:36450232-36450254 GGTGTTCAGCCTGCCAGCAGGGG No data
1146882084_1146882093 25 Left 1146882084 17:36450184-36450206 CCACGTTGTGGCTCAGTGCAGCG No data
Right 1146882093 17:36450232-36450254 GGTGTTCAGCCTGCCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882093 Original CRISPR GGTGTTCAGCCTGCCAGCAG GGG Intergenic
No off target data available for this crispr