ID: 1146882094

View in Genome Browser
Species Human (GRCh38)
Location 17:36450233-36450255
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882088_1146882094 -10 Left 1146882088 17:36450220-36450242 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1146882094 17:36450233-36450255 GTGTTCAGCCTGCCAGCAGGGGG No data
1146882083_1146882094 27 Left 1146882083 17:36450183-36450205 CCCACGTTGTGGCTCAGTGCAGC No data
Right 1146882094 17:36450233-36450255 GTGTTCAGCCTGCCAGCAGGGGG No data
1146882084_1146882094 26 Left 1146882084 17:36450184-36450206 CCACGTTGTGGCTCAGTGCAGCG No data
Right 1146882094 17:36450233-36450255 GTGTTCAGCCTGCCAGCAGGGGG No data
1146882086_1146882094 -1 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882094 17:36450233-36450255 GTGTTCAGCCTGCCAGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882094 Original CRISPR GTGTTCAGCCTGCCAGCAGG GGG Intergenic