ID: 1146882095

View in Genome Browser
Species Human (GRCh38)
Location 17:36450241-36450263
Sequence CCAGCTGGCCCCCTGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882095_1146882107 28 Left 1146882095 17:36450241-36450263 CCTGCCAGCAGGGGGCCAGCTGG No data
Right 1146882107 17:36450292-36450314 AGCTCTGTCTGAAATCATAATGG No data
1146882095_1146882102 -2 Left 1146882095 17:36450241-36450263 CCTGCCAGCAGGGGGCCAGCTGG No data
Right 1146882102 17:36450262-36450284 GGTCCTCCTGGGATATGGCACGG No data
1146882095_1146882101 -7 Left 1146882095 17:36450241-36450263 CCTGCCAGCAGGGGGCCAGCTGG No data
Right 1146882101 17:36450257-36450279 CAGCTGGTCCTCCTGGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882095 Original CRISPR CCAGCTGGCCCCCTGCTGGC AGG (reversed) Intergenic
No off target data available for this crispr