ID: 1146882097

View in Genome Browser
Species Human (GRCh38)
Location 17:36450245-36450267
Sequence AGGACCAGCTGGCCCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882097_1146882108 27 Left 1146882097 17:36450245-36450267 CCAGCAGGGGGCCAGCTGGTCCT No data
Right 1146882108 17:36450295-36450317 TCTGTCTGAAATCATAATGGCGG No data
1146882097_1146882107 24 Left 1146882097 17:36450245-36450267 CCAGCAGGGGGCCAGCTGGTCCT No data
Right 1146882107 17:36450292-36450314 AGCTCTGTCTGAAATCATAATGG No data
1146882097_1146882102 -6 Left 1146882097 17:36450245-36450267 CCAGCAGGGGGCCAGCTGGTCCT No data
Right 1146882102 17:36450262-36450284 GGTCCTCCTGGGATATGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882097 Original CRISPR AGGACCAGCTGGCCCCCTGC TGG (reversed) Intergenic
No off target data available for this crispr