ID: 1146882099

View in Genome Browser
Species Human (GRCh38)
Location 17:36450251-36450273
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882086_1146882099 17 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882099 17:36450251-36450273 GGGGGCCAGCTGGTCCTCCTGGG No data
1146882088_1146882099 8 Left 1146882088 17:36450220-36450242 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1146882099 17:36450251-36450273 GGGGGCCAGCTGGTCCTCCTGGG No data
1146882090_1146882099 2 Left 1146882090 17:36450226-36450248 CCGCAGGGTGTTCAGCCTGCCAG No data
Right 1146882099 17:36450251-36450273 GGGGGCCAGCTGGTCCTCCTGGG No data
1146882089_1146882099 7 Left 1146882089 17:36450221-36450243 CCGCTCCGCAGGGTGTTCAGCCT No data
Right 1146882099 17:36450251-36450273 GGGGGCCAGCTGGTCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882099 Original CRISPR GGGGGCCAGCTGGTCCTCCT GGG Intergenic