ID: 1146882102

View in Genome Browser
Species Human (GRCh38)
Location 17:36450262-36450284
Sequence GGTCCTCCTGGGATATGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882089_1146882102 18 Left 1146882089 17:36450221-36450243 CCGCTCCGCAGGGTGTTCAGCCT No data
Right 1146882102 17:36450262-36450284 GGTCCTCCTGGGATATGGCACGG No data
1146882088_1146882102 19 Left 1146882088 17:36450220-36450242 CCCGCTCCGCAGGGTGTTCAGCC No data
Right 1146882102 17:36450262-36450284 GGTCCTCCTGGGATATGGCACGG No data
1146882097_1146882102 -6 Left 1146882097 17:36450245-36450267 CCAGCAGGGGGCCAGCTGGTCCT No data
Right 1146882102 17:36450262-36450284 GGTCCTCCTGGGATATGGCACGG No data
1146882086_1146882102 28 Left 1146882086 17:36450211-36450233 CCGATCTCACCCGCTCCGCAGGG No data
Right 1146882102 17:36450262-36450284 GGTCCTCCTGGGATATGGCACGG No data
1146882090_1146882102 13 Left 1146882090 17:36450226-36450248 CCGCAGGGTGTTCAGCCTGCCAG No data
Right 1146882102 17:36450262-36450284 GGTCCTCCTGGGATATGGCACGG No data
1146882095_1146882102 -2 Left 1146882095 17:36450241-36450263 CCTGCCAGCAGGGGGCCAGCTGG No data
Right 1146882102 17:36450262-36450284 GGTCCTCCTGGGATATGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882102 Original CRISPR GGTCCTCCTGGGATATGGCA CGG Intergenic
No off target data available for this crispr