ID: 1146882112

View in Genome Browser
Species Human (GRCh38)
Location 17:36450320-36450342
Sequence ACCTGGACGTAGAGGGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882112_1146882120 -8 Left 1146882112 17:36450320-36450342 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1146882120 17:36450335-36450357 GTCCAGGTCGGTTGGGAGGCGGG No data
1146882112_1146882119 -9 Left 1146882112 17:36450320-36450342 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1146882119 17:36450334-36450356 CGTCCAGGTCGGTTGGGAGGCGG No data
1146882112_1146882123 -2 Left 1146882112 17:36450320-36450342 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1146882123 17:36450341-36450363 GTCGGTTGGGAGGCGGGGCATGG No data
1146882112_1146882125 22 Left 1146882112 17:36450320-36450342 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1146882125 17:36450365-36450387 GTTCCACTGCAGGAATCTCCAGG No data
1146882112_1146882124 12 Left 1146882112 17:36450320-36450342 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1146882124 17:36450355-36450377 GGGGCATGGAGTTCCACTGCAGG No data
1146882112_1146882121 -7 Left 1146882112 17:36450320-36450342 CCAAGGGCCCTCTACGTCCAGGT No data
Right 1146882121 17:36450336-36450358 TCCAGGTCGGTTGGGAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882112 Original CRISPR ACCTGGACGTAGAGGGCCCT TGG (reversed) Intergenic
No off target data available for this crispr