ID: 1146882147

View in Genome Browser
Species Human (GRCh38)
Location 17:36450438-36450460
Sequence CGGGAAGACACCTACCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146882147_1146882155 3 Left 1146882147 17:36450438-36450460 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1146882155 17:36450464-36450486 AGCCCCACCAGGACAGGGTGTGG No data
1146882147_1146882161 22 Left 1146882147 17:36450438-36450460 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1146882161 17:36450483-36450505 GTGGAAGAACGAGGTGCCCGTGG No data
1146882147_1146882164 27 Left 1146882147 17:36450438-36450460 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1146882164 17:36450488-36450510 AGAACGAGGTGCCCGTGGCGGGG No data
1146882147_1146882160 13 Left 1146882147 17:36450438-36450460 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1146882160 17:36450474-36450496 GGACAGGGTGTGGAAGAACGAGG No data
1146882147_1146882162 25 Left 1146882147 17:36450438-36450460 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1146882162 17:36450486-36450508 GAAGAACGAGGTGCCCGTGGCGG No data
1146882147_1146882163 26 Left 1146882147 17:36450438-36450460 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1146882163 17:36450487-36450509 AAGAACGAGGTGCCCGTGGCGGG No data
1146882147_1146882153 -3 Left 1146882147 17:36450438-36450460 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1146882153 17:36450458-36450480 CCGGACAGCCCCACCAGGACAGG No data
1146882147_1146882150 -8 Left 1146882147 17:36450438-36450460 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1146882150 17:36450453-36450475 TCTTCCCGGACAGCCCCACCAGG No data
1146882147_1146882154 -2 Left 1146882147 17:36450438-36450460 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1146882154 17:36450459-36450481 CGGACAGCCCCACCAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146882147 Original CRISPR CGGGAAGACACCTACCCTGT GGG (reversed) Intergenic
No off target data available for this crispr