ID: 1146883193

View in Genome Browser
Species Human (GRCh38)
Location 17:36454970-36454992
Sequence TGCACATTGGTTTGGAACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146883193_1146883199 10 Left 1146883193 17:36454970-36454992 CCACGGTTCCAAACCAATGTGCA No data
Right 1146883199 17:36455003-36455025 GCCACCGCTCCAGCCCCTCCTGG No data
1146883193_1146883201 11 Left 1146883193 17:36454970-36454992 CCACGGTTCCAAACCAATGTGCA No data
Right 1146883201 17:36455004-36455026 CCACCGCTCCAGCCCCTCCTGGG No data
1146883193_1146883202 12 Left 1146883193 17:36454970-36454992 CCACGGTTCCAAACCAATGTGCA No data
Right 1146883202 17:36455005-36455027 CACCGCTCCAGCCCCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146883193 Original CRISPR TGCACATTGGTTTGGAACCG TGG (reversed) Intergenic