ID: 1146883196

View in Genome Browser
Species Human (GRCh38)
Location 17:36454983-36455005
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146883196_1146883202 -1 Left 1146883196 17:36454983-36455005 CCAATGTGCAGAGTCTCCCGGCC No data
Right 1146883202 17:36455005-36455027 CACCGCTCCAGCCCCTCCTGGGG No data
1146883196_1146883210 27 Left 1146883196 17:36454983-36455005 CCAATGTGCAGAGTCTCCCGGCC No data
Right 1146883210 17:36455033-36455055 CCTTCATCCTCCAAGTCTCCAGG No data
1146883196_1146883199 -3 Left 1146883196 17:36454983-36455005 CCAATGTGCAGAGTCTCCCGGCC No data
Right 1146883199 17:36455003-36455025 GCCACCGCTCCAGCCCCTCCTGG No data
1146883196_1146883211 28 Left 1146883196 17:36454983-36455005 CCAATGTGCAGAGTCTCCCGGCC No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883196_1146883201 -2 Left 1146883196 17:36454983-36455005 CCAATGTGCAGAGTCTCCCGGCC No data
Right 1146883201 17:36455004-36455026 CCACCGCTCCAGCCCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146883196 Original CRISPR GGCCGGGAGACTCTGCACAT TGG (reversed) Intergenic