ID: 1146883197

View in Genome Browser
Species Human (GRCh38)
Location 17:36454999-36455021
Sequence GAGGGGCTGGAGCGGTGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146883197_1146883211 12 Left 1146883197 17:36454999-36455021 CCCGGCCACCGCTCCAGCCCCTC No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883197_1146883212 15 Left 1146883197 17:36454999-36455021 CCCGGCCACCGCTCCAGCCCCTC No data
Right 1146883212 17:36455037-36455059 CATCCTCCAAGTCTCCAGGGTGG No data
1146883197_1146883210 11 Left 1146883197 17:36454999-36455021 CCCGGCCACCGCTCCAGCCCCTC No data
Right 1146883210 17:36455033-36455055 CCTTCATCCTCCAAGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146883197 Original CRISPR GAGGGGCTGGAGCGGTGGCC GGG (reversed) Intergenic
No off target data available for this crispr