ID: 1146883200

View in Genome Browser
Species Human (GRCh38)
Location 17:36455004-36455026
Sequence CCCAGGAGGGGCTGGAGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146883200_1146883212 10 Left 1146883200 17:36455004-36455026 CCACCGCTCCAGCCCCTCCTGGG No data
Right 1146883212 17:36455037-36455059 CATCCTCCAAGTCTCCAGGGTGG No data
1146883200_1146883211 7 Left 1146883200 17:36455004-36455026 CCACCGCTCCAGCCCCTCCTGGG No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883200_1146883210 6 Left 1146883200 17:36455004-36455026 CCACCGCTCCAGCCCCTCCTGGG No data
Right 1146883210 17:36455033-36455055 CCTTCATCCTCCAAGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146883200 Original CRISPR CCCAGGAGGGGCTGGAGCGG TGG (reversed) Intergenic
No off target data available for this crispr