ID: 1146883200 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:36455004-36455026 |
| Sequence | CCCAGGAGGGGCTGGAGCGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1146883200_1146883211 | 7 | Left | 1146883200 | 17:36455004-36455026 | CCACCGCTCCAGCCCCTCCTGGG | No data | ||
| Right | 1146883211 | 17:36455034-36455056 | CTTCATCCTCCAAGTCTCCAGGG | No data | ||||
| 1146883200_1146883212 | 10 | Left | 1146883200 | 17:36455004-36455026 | CCACCGCTCCAGCCCCTCCTGGG | No data | ||
| Right | 1146883212 | 17:36455037-36455059 | CATCCTCCAAGTCTCCAGGGTGG | No data | ||||
| 1146883200_1146883210 | 6 | Left | 1146883200 | 17:36455004-36455026 | CCACCGCTCCAGCCCCTCCTGGG | No data | ||
| Right | 1146883210 | 17:36455033-36455055 | CCTTCATCCTCCAAGTCTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1146883200 | Original CRISPR | CCCAGGAGGGGCTGGAGCGG TGG (reversed) | Intergenic | ||