ID: 1146883202

View in Genome Browser
Species Human (GRCh38)
Location 17:36455005-36455027
Sequence CACCGCTCCAGCCCCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146883193_1146883202 12 Left 1146883193 17:36454970-36454992 CCACGGTTCCAAACCAATGTGCA No data
Right 1146883202 17:36455005-36455027 CACCGCTCCAGCCCCTCCTGGGG No data
1146883192_1146883202 15 Left 1146883192 17:36454967-36454989 CCTCCACGGTTCCAAACCAATGT No data
Right 1146883202 17:36455005-36455027 CACCGCTCCAGCCCCTCCTGGGG No data
1146883194_1146883202 4 Left 1146883194 17:36454978-36455000 CCAAACCAATGTGCAGAGTCTCC No data
Right 1146883202 17:36455005-36455027 CACCGCTCCAGCCCCTCCTGGGG No data
1146883196_1146883202 -1 Left 1146883196 17:36454983-36455005 CCAATGTGCAGAGTCTCCCGGCC No data
Right 1146883202 17:36455005-36455027 CACCGCTCCAGCCCCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146883202 Original CRISPR CACCGCTCCAGCCCCTCCTG GGG Intergenic