ID: 1146883204

View in Genome Browser
Species Human (GRCh38)
Location 17:36455012-36455034
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146883204_1146883212 2 Left 1146883204 17:36455012-36455034 CCAGCCCCTCCTGGGGCGACTCC No data
Right 1146883212 17:36455037-36455059 CATCCTCCAAGTCTCCAGGGTGG No data
1146883204_1146883211 -1 Left 1146883204 17:36455012-36455034 CCAGCCCCTCCTGGGGCGACTCC No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883204_1146883210 -2 Left 1146883204 17:36455012-36455034 CCAGCCCCTCCTGGGGCGACTCC No data
Right 1146883210 17:36455033-36455055 CCTTCATCCTCCAAGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146883204 Original CRISPR GGAGTCGCCCCAGGAGGGGC TGG (reversed) Intergenic