ID: 1146883204 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:36455012-36455034 |
Sequence | GGAGTCGCCCCAGGAGGGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1146883204_1146883212 | 2 | Left | 1146883204 | 17:36455012-36455034 | CCAGCCCCTCCTGGGGCGACTCC | No data | ||
Right | 1146883212 | 17:36455037-36455059 | CATCCTCCAAGTCTCCAGGGTGG | No data | ||||
1146883204_1146883211 | -1 | Left | 1146883204 | 17:36455012-36455034 | CCAGCCCCTCCTGGGGCGACTCC | No data | ||
Right | 1146883211 | 17:36455034-36455056 | CTTCATCCTCCAAGTCTCCAGGG | No data | ||||
1146883204_1146883210 | -2 | Left | 1146883204 | 17:36455012-36455034 | CCAGCCCCTCCTGGGGCGACTCC | No data | ||
Right | 1146883210 | 17:36455033-36455055 | CCTTCATCCTCCAAGTCTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1146883204 | Original CRISPR | GGAGTCGCCCCAGGAGGGGC TGG (reversed) | Intergenic | ||