ID: 1146883207

View in Genome Browser
Species Human (GRCh38)
Location 17:36455018-36455040
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146883207_1146883212 -4 Left 1146883207 17:36455018-36455040 CCTCCTGGGGCGACTCCTTCATC No data
Right 1146883212 17:36455037-36455059 CATCCTCCAAGTCTCCAGGGTGG No data
1146883207_1146883210 -8 Left 1146883207 17:36455018-36455040 CCTCCTGGGGCGACTCCTTCATC No data
Right 1146883210 17:36455033-36455055 CCTTCATCCTCCAAGTCTCCAGG No data
1146883207_1146883211 -7 Left 1146883207 17:36455018-36455040 CCTCCTGGGGCGACTCCTTCATC No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146883207 Original CRISPR GATGAAGGAGTCGCCCCAGG AGG (reversed) Intergenic