ID: 1146883208

View in Genome Browser
Species Human (GRCh38)
Location 17:36455021-36455043
Sequence GAGGATGAAGGAGTCGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146883208_1146883211 -10 Left 1146883208 17:36455021-36455043 CCTGGGGCGACTCCTTCATCCTC No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883208_1146883212 -7 Left 1146883208 17:36455021-36455043 CCTGGGGCGACTCCTTCATCCTC No data
Right 1146883212 17:36455037-36455059 CATCCTCCAAGTCTCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146883208 Original CRISPR GAGGATGAAGGAGTCGCCCC AGG (reversed) Intergenic