ID: 1146883211

View in Genome Browser
Species Human (GRCh38)
Location 17:36455034-36455056
Sequence CTTCATCCTCCAAGTCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146883204_1146883211 -1 Left 1146883204 17:36455012-36455034 CCAGCCCCTCCTGGGGCGACTCC No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883206_1146883211 -6 Left 1146883206 17:36455017-36455039 CCCTCCTGGGGCGACTCCTTCAT No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883205_1146883211 -5 Left 1146883205 17:36455016-36455038 CCCCTCCTGGGGCGACTCCTTCA No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883208_1146883211 -10 Left 1146883208 17:36455021-36455043 CCTGGGGCGACTCCTTCATCCTC No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883196_1146883211 28 Left 1146883196 17:36454983-36455005 CCAATGTGCAGAGTCTCCCGGCC No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883207_1146883211 -7 Left 1146883207 17:36455018-36455040 CCTCCTGGGGCGACTCCTTCATC No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883203_1146883211 4 Left 1146883203 17:36455007-36455029 CCGCTCCAGCCCCTCCTGGGGCG No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883198_1146883211 11 Left 1146883198 17:36455000-36455022 CCGGCCACCGCTCCAGCCCCTCC No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883197_1146883211 12 Left 1146883197 17:36454999-36455021 CCCGGCCACCGCTCCAGCCCCTC No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data
1146883200_1146883211 7 Left 1146883200 17:36455004-36455026 CCACCGCTCCAGCCCCTCCTGGG No data
Right 1146883211 17:36455034-36455056 CTTCATCCTCCAAGTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146883211 Original CRISPR CTTCATCCTCCAAGTCTCCA GGG Intergenic
No off target data available for this crispr