ID: 1146884554

View in Genome Browser
Species Human (GRCh38)
Location 17:36462424-36462446
Sequence GCTGCTCTGCCCCATGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146884554_1146884563 23 Left 1146884554 17:36462424-36462446 CCTCAACCATGGGGCAGAGCAGC No data
Right 1146884563 17:36462470-36462492 ATCTGTCTCAGACATCATCCAGG No data
1146884554_1146884564 24 Left 1146884554 17:36462424-36462446 CCTCAACCATGGGGCAGAGCAGC No data
Right 1146884564 17:36462471-36462493 TCTGTCTCAGACATCATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146884554 Original CRISPR GCTGCTCTGCCCCATGGTTG AGG (reversed) Intergenic
No off target data available for this crispr