ID: 1146884765

View in Genome Browser
Species Human (GRCh38)
Location 17:36463757-36463779
Sequence CTACCTATGGGGTGGTGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146884765_1146884778 -9 Left 1146884765 17:36463757-36463779 CCCCCCCACCACCCCATAGGTAG No data
Right 1146884778 17:36463771-36463793 CATAGGTAGCAGGGTCTGCTGGG No data
1146884765_1146884780 6 Left 1146884765 17:36463757-36463779 CCCCCCCACCACCCCATAGGTAG No data
Right 1146884780 17:36463786-36463808 CTGCTGGGCTTGGATGCCAGTGG No data
1146884765_1146884779 -4 Left 1146884765 17:36463757-36463779 CCCCCCCACCACCCCATAGGTAG No data
Right 1146884779 17:36463776-36463798 GTAGCAGGGTCTGCTGGGCTTGG No data
1146884765_1146884781 7 Left 1146884765 17:36463757-36463779 CCCCCCCACCACCCCATAGGTAG No data
Right 1146884781 17:36463787-36463809 TGCTGGGCTTGGATGCCAGTGGG No data
1146884765_1146884777 -10 Left 1146884765 17:36463757-36463779 CCCCCCCACCACCCCATAGGTAG No data
Right 1146884777 17:36463770-36463792 CCATAGGTAGCAGGGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146884765 Original CRISPR CTACCTATGGGGTGGTGGGG GGG (reversed) Intergenic
No off target data available for this crispr