ID: 1146889641

View in Genome Browser
Species Human (GRCh38)
Location 17:36498102-36498124
Sequence AATCCAAACCTGCAGCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146889640_1146889641 -3 Left 1146889640 17:36498082-36498104 CCAGTTATAACAAAATAAATAAT 0: 1
1: 0
2: 8
3: 69
4: 1035
Right 1146889641 17:36498102-36498124 AATCCAAACCTGCAGCTGATTGG 0: 1
1: 0
2: 2
3: 18
4: 309
1146889639_1146889641 -2 Left 1146889639 17:36498081-36498103 CCCAGTTATAACAAAATAAATAA 0: 1
1: 1
2: 7
3: 100
4: 1410
Right 1146889641 17:36498102-36498124 AATCCAAACCTGCAGCTGATTGG 0: 1
1: 0
2: 2
3: 18
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146889641 Original CRISPR AATCCAAACCTGCAGCTGAT TGG Intronic
901024432 1:6271647-6271669 AACCCAGGCCTGCAGCTGCTGGG - Intronic
903341374 1:22656812-22656834 AACCCCAACTTGAAGCTGATTGG - Intronic
903502795 1:23810898-23810920 AATCAACACCTGCAGCTGGGCGG + Intronic
904255667 1:29253001-29253023 AACCCCAACCTGCAGCGGGTCGG - Intronic
904888455 1:33759984-33760006 AATCCTAAACTGAAGCTCATTGG + Intronic
906363172 1:45181439-45181461 AGACCAAATCTGCATCTGATTGG + Intronic
906881950 1:49601263-49601285 AGACCAAACCTGCATTTGATTGG - Intronic
907005504 1:50909511-50909533 AGACCAAATCTGCATCTGATTGG - Intronic
908450868 1:64253270-64253292 ACACCAAACCTACAACTGATTGG + Intronic
909374636 1:74925404-74925426 AGACCAAACCTACAACTGATTGG + Intergenic
909552413 1:76913555-76913577 AGACCAAATCTGCATCTGATTGG - Intronic
910339225 1:86166979-86167001 AAACCAAATCTACATCTGATTGG - Intergenic
910818563 1:91319934-91319956 ATTCAAAACCAGCAGCTGCTGGG + Intronic
912045450 1:105448340-105448362 AAACCGAACCTACAACTGATTGG - Intergenic
913299602 1:117357200-117357222 AGACCAAATCTGCATCTGATTGG - Intergenic
914404760 1:147359470-147359492 AAACCAAACCTACAATTGATTGG + Intergenic
915639652 1:157214739-157214761 AAATCAAACCTACATCTGATAGG - Intergenic
916895625 1:169159090-169159112 AATCATAACCTGAAGCTGTTGGG + Intronic
917827530 1:178839017-178839039 AGACCAAACCTGCGTCTGATTGG + Intronic
918614654 1:186530788-186530810 AGACCAAACCTGCGACTGATTGG - Intergenic
918684510 1:187397699-187397721 ACTCCAGACCTGCAGCAGAGGGG + Intergenic
920787218 1:209052856-209052878 AAACTAAATCTACAGCTGATTGG + Intergenic
921539577 1:216397498-216397520 TAGACACACCTGCAGCTGATTGG - Intronic
921842267 1:219840828-219840850 AGACCAAACCTACATCTGATTGG + Intronic
923195367 1:231661377-231661399 AGACCAAACCTCCAACTGATTGG - Intronic
1063400304 10:5737391-5737413 AAGCCAAAACTGCAGCATATGGG - Intronic
1065633170 10:27702992-27703014 ATTCCAAACCTGAAGCTTTTCGG - Intronic
1067903243 10:50263885-50263907 AGACCAAACCTACATCTGATTGG + Intergenic
1067996598 10:51280506-51280528 AGACCAAACCTACATCTGATTGG - Intronic
1069110516 10:64441005-64441027 AGACCAAATCTGCATCTGATTGG - Intergenic
1071312216 10:84353563-84353585 AAATCACACCTGCAGCTGAATGG - Intronic
1071472753 10:85995754-85995776 ACTCCAAAGCCACAGCTGATTGG + Intronic
1071701378 10:87940923-87940945 AATGCAAACCTGAAGCTATTAGG - Intronic
1071849768 10:89557057-89557079 AACCCCAACTTGAAGCTGATTGG + Intergenic
1072004253 10:91227889-91227911 AACCCAAATCTGCAGGTGGTAGG - Intronic
1072023676 10:91431516-91431538 AAACCAAATCTGCGTCTGATTGG - Intronic
1072306340 10:94111242-94111264 AATCCCACCCTGCAGCTGGAAGG - Intronic
1073764412 10:106666227-106666249 AATTCAGGCCTTCAGCTGATTGG - Intronic
1073816452 10:107213136-107213158 AAACCAAACCTACAGCTCATTGG - Intergenic
1074289451 10:112127445-112127467 AAATCAATCCTCCAGCTGATGGG - Intergenic
1074636185 10:115320528-115320550 AAACCAAACTTGCAATTGATTGG - Intronic
1076134365 10:128035610-128035632 GGTCAAAACCTGCAGCTGTTTGG - Intronic
1079598800 11:22286138-22286160 AGACCAAACCTACATCTGATTGG + Intergenic
1080082425 11:28237238-28237260 AGACCAAATCTGCATCTGATTGG - Intronic
1082606242 11:55237461-55237483 AGACCAAATCTGCATCTGATTGG - Intergenic
1083288429 11:61676015-61676037 CATCCCATCCTGCAGCTGCTGGG + Intergenic
1085335019 11:75686765-75686787 AGACCAAACCTACAACTGATTGG - Intergenic
1085840735 11:80008965-80008987 AATCAAAACCAGCACCTGAAAGG - Intergenic
1085845508 11:80060252-80060274 AAACCAAGCCTGAAGATGATGGG + Intergenic
1086236515 11:84637559-84637581 AACCCAAAACTGCAGCTGCTTGG + Intronic
1086417121 11:86599456-86599478 AGACCAAATCTGCATCTGATTGG + Intronic
1087233843 11:95696471-95696493 AACCCCAACTTGAAGCTGATCGG - Intergenic
1088211786 11:107465167-107465189 AGACCAAACCTGCATTTGATTGG - Intergenic
1088383237 11:109220329-109220351 AGACCAAACCTACAACTGATTGG - Intergenic
1088703253 11:112433804-112433826 AGACCAAACCTGCTACTGATTGG - Intergenic
1090807698 11:130212685-130212707 AGTCCAGACCTGCAGCAGCTGGG + Intergenic
1091501639 12:1023423-1023445 AAACCAAACCTGCTGCTGCAGGG - Intronic
1091656195 12:2348407-2348429 AATCCAAACGTGGAGGTGATTGG + Intronic
1092102768 12:5900030-5900052 ACTCCAAAGCTGCAGTGGATAGG + Intronic
1092495064 12:8985558-8985580 AATCCCAACTTGAAGCTTATTGG - Intronic
1093271562 12:17068617-17068639 AAGCCAATCCTGCAGATGAAGGG + Intergenic
1095562280 12:43580181-43580203 AATACACTCCTTCAGCTGATGGG + Intergenic
1097308136 12:58091338-58091360 AATCTAATGCTGCTGCTGATCGG + Intergenic
1097421998 12:59391505-59391527 AGACCAAACCTACAACTGATTGG + Intergenic
1097550534 12:61062475-61062497 AGTCCAAATCTACATCTGATTGG + Intergenic
1097809919 12:64007407-64007429 AATCTAATGCTGCGGCTGATCGG + Intronic
1099059518 12:77888993-77889015 CCTCCAAACCTGCATCTGCTGGG + Intronic
1099919021 12:88934054-88934076 AATCCAAATATGTAGCAGATGGG - Intergenic
1100663718 12:96728313-96728335 ACACCAAATCTGCATCTGATTGG - Intronic
1101069699 12:101061517-101061539 AAACCAAACCTACATTTGATTGG - Intronic
1101186647 12:102287833-102287855 AGACCAAACCTACAACTGATTGG - Intergenic
1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG + Intergenic
1102372646 12:112395069-112395091 AGACCAAACCTGCAATTGATTGG + Intergenic
1105311403 13:19215363-19215385 AGACCAAACCTACATCTGATTGG - Intergenic
1105875868 13:24553046-24553068 AGACCAAACCTACATCTGATTGG - Intergenic
1106609484 13:31264730-31264752 GATCCAATGTTGCAGCTGATGGG - Intronic
1108262642 13:48674258-48674280 AGACCAAACCTACATCTGATTGG - Intronic
1109146746 13:58789439-58789461 AAACCGAACCTACAACTGATTGG - Intergenic
1109968892 13:69738757-69738779 AGACCAAACCTACATCTGATAGG + Intronic
1111183183 13:84695077-84695099 AAACCAAAGCTGCAACTGATGGG + Intergenic
1114390683 14:22304583-22304605 TACCCAAACCTGCAGCTGGTGGG + Intergenic
1114911079 14:27198160-27198182 ATTCCAAACCTGTAGCTGGATGG - Intergenic
1114958330 14:27850459-27850481 AGACCAAACCTACAACTGATTGG + Intergenic
1116536688 14:46040616-46040638 AGGCCAAACCTGCAACTCATTGG - Intergenic
1116570531 14:46510060-46510082 AGACCAAATCTGCATCTGATTGG + Intergenic
1116775867 14:49179980-49180002 AAACCAAACCTACATTTGATTGG + Intergenic
1117511506 14:56455948-56455970 AGACCAAATCTGCATCTGATTGG + Intergenic
1117614337 14:57518181-57518203 AGACCAAACCTACATCTGATAGG - Intergenic
1117710870 14:58527210-58527232 AGACCAAACCTACATCTGATTGG + Intronic
1118446814 14:65859497-65859519 AGACCAAATCTGCATCTGATTGG - Intergenic
1118558385 14:67051466-67051488 AGACCAAACCTACAACTGATTGG + Intronic
1120163334 14:81168682-81168704 AACCCCAACTTGAAGCTGATTGG + Intergenic
1120407333 14:84105414-84105436 AATACAAACCTGAAGGTGGTTGG - Intergenic
1120868657 14:89317840-89317862 AATCTAATGCTGCAGCTGATGGG - Intronic
1121839119 14:97118060-97118082 AATCCCATCCTGAAGCTGAATGG + Intergenic
1124714809 15:32050282-32050304 AGACCAAATCTGCATCTGATTGG - Intronic
1126542367 15:49837860-49837882 AGACCAAACCTACATCTGATTGG - Intergenic
1127042500 15:54992089-54992111 AGACCAAACCTACAACTGATTGG + Intergenic
1128907530 15:71481119-71481141 AATAAAAACCTGCATTTGATTGG + Intronic
1129796386 15:78380579-78380601 AAACCAAATCTACATCTGATTGG - Intergenic
1130699685 15:86165888-86165910 ACTCCAAGCCTGTAGCTGATGGG + Intronic
1132130737 15:99276001-99276023 AATCTAATGCTGCTGCTGATGGG - Intronic
1132196714 15:99919158-99919180 TATTCAGACCTTCAGCTGATTGG + Intergenic
1133955794 16:10442904-10442926 ATTCAAACCCTGCAGCTGTTTGG + Intronic
1134184590 16:12074801-12074823 AGACCAAATCTGCATCTGATTGG - Intronic
1135037620 16:19091128-19091150 CATTCAAACCTTCAACTGATTGG - Intergenic
1137545079 16:49397077-49397099 AGTCCAAACATGCAGCAGGTAGG - Intronic
1139688118 16:68620231-68620253 AGTCAAATTCTGCAGCTGATAGG - Intergenic
1140821912 16:78670548-78670570 AATCCAAACCTGGGGCTGGCTGG - Intronic
1141836536 16:86543880-86543902 AATCTAATGCCGCAGCTGATCGG - Intronic
1143043312 17:4055986-4056008 AATCCAATGCCGCAGCTGATCGG + Intronic
1144176438 17:12712308-12712330 GCTCCAAGCCTGCAGCTGAATGG + Intronic
1146120894 17:30193479-30193501 AATCTAATGCTGCCGCTGATGGG - Intergenic
1146614397 17:34342093-34342115 AATTCAAGCCTTCAACTGATTGG + Intergenic
1146758900 17:35458398-35458420 AGACCAAACCTACAACTGATTGG - Intergenic
1146889641 17:36498102-36498124 AATCCAAACCTGCAGCTGATTGG + Intronic
1147191783 17:38742166-38742188 AAACCAAACCTGCACCTGGAAGG + Intronic
1147496841 17:40924743-40924765 AAACCAAGCTTGCAGCTGAAAGG - Intronic
1149225387 17:54464529-54464551 AAACCAAATCTACATCTGATTGG - Intergenic
1151284663 17:73101373-73101395 AATCCAAACCTGCACCACACAGG + Intergenic
1153937156 18:9938384-9938406 AAACCAAACCAGAAGTTGATGGG + Intronic
1155991711 18:32285233-32285255 AGTCCAGACCTGTAGCTGCTGGG + Intronic
1156206961 18:34896271-34896293 AGACCAAATCTGCATCTGATTGG + Intergenic
1156414994 18:36878649-36878671 AAACCAAACCTACATTTGATTGG - Intronic
1157016450 18:43720586-43720608 AGACCAAACCTACAACTGATTGG + Intergenic
1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG + Intronic
1158403813 18:57143706-57143728 GATGCACACCTGCAGCTGCTCGG + Intergenic
1159316152 18:66776198-66776220 TACCCAAACCCTCAGCTGATTGG + Intergenic
1159592204 18:70347584-70347606 AGACCAAACCTACATCTGATTGG - Intronic
1163858431 19:19725713-19725735 AATACAAATCTACATCTGATTGG - Intronic
1164246492 19:23434768-23434790 AGACCAAATCTGCATCTGATTGG - Intergenic
1164291639 19:23874722-23874744 AATCTAATGCTGCTGCTGATCGG + Intergenic
1164506583 19:28866155-28866177 AATCCCAACTTACAGCTGATGGG + Intergenic
1166634577 19:44438971-44438993 AACCCCAACTTGCAGCTGGTTGG + Intronic
1167857029 19:52250405-52250427 TATCCAAGCCTTCAACTGATTGG - Intergenic
1167871896 19:52377583-52377605 AACCCCAACCTGTAGCTGGTTGG - Intronic
925360948 2:3279945-3279967 CTTGCAAAACTGCAGCTGATAGG - Intronic
925374235 2:3370743-3370765 AGACCAAATCTGCACCTGATTGG + Intronic
926658906 2:15441011-15441033 AGACCAAATCTGCATCTGATTGG + Intronic
929896802 2:45967745-45967767 AACCCAAACCTCAAGCTGAGAGG - Intronic
931695256 2:64866048-64866070 AATCAAAGCCTGCAGGTGAAGGG - Intergenic
932409024 2:71534399-71534421 GATCCAAACCAGCAGCTCACAGG - Intronic
932421468 2:71603953-71603975 AAATCAAAACTGCAGCTCATGGG + Intronic
932943815 2:76203244-76203266 TATCCAGGCCTTCAGCTGATTGG + Intergenic
934478970 2:94617585-94617607 AGACCAAACCTACAACTGATTGG - Intergenic
934698759 2:96421565-96421587 AGACCAAACCTACAGTTGATTGG - Intergenic
937562858 2:123246238-123246260 AGACCAAACCTGCAATTGATTGG + Intergenic
937740089 2:125340999-125341021 CAACCAAACCTGCAACTTATTGG + Intergenic
939783698 2:146481719-146481741 AAACCAAACCTGCTTCTAATGGG + Intergenic
941075458 2:161002139-161002161 AGACCAAATCTGCATCTGATTGG - Intergenic
941075666 2:161003639-161003661 AGACCAAATCTGCATCTGATTGG + Intergenic
941403778 2:165063538-165063560 AATCTAATGCTGCTGCTGATGGG + Intergenic
941894218 2:170613220-170613242 ACTCCAAACCAGAAGTTGATGGG - Intronic
942317910 2:174711446-174711468 ACTCCAAACCAGCAGCTGAGGGG - Intergenic
945348698 2:208751124-208751146 AGACCAAATCTGCATCTGATTGG - Intronic
1170266238 20:14469561-14469583 AGACCAAACCTACAACTGATTGG - Intronic
1171353423 20:24523165-24523187 AATCCAGCTCTGCAGCTTATAGG + Intronic
1172228437 20:33320890-33320912 AATTCTGAACTGCAGCTGATTGG + Intergenic
1172686308 20:36757720-36757742 CCCCCAAACCTGCAGCTCATAGG + Intronic
1173371532 20:42440905-42440927 TATTCAGACCTTCAGCTGATGGG + Intronic
1177129819 21:17242002-17242024 AGACCAAACCTGCATTTGATTGG + Intergenic
1177237525 21:18412038-18412060 GATCTAAACTAGCAGCTGATTGG - Intronic
1178702730 21:34846914-34846936 AGTCAAAAACTGCAGCTGCTTGG - Intronic
1179060355 21:37973754-37973776 TATCCAGGCCTGCAGCAGATGGG + Intronic
1179609444 21:42540385-42540407 AAGGAAAACCTGCAGCTGGTTGG + Intronic
1180176070 21:46090452-46090474 CCTCCAAGCCTTCAGCTGATGGG + Intergenic
1180419798 22:12802826-12802848 AGACCAAATCTGCATCTGATTGG + Intergenic
950150957 3:10687028-10687050 AATACACAGCTGCAGCTGATAGG + Intronic
950597073 3:13994339-13994361 AGACCAAACCTACATCTGATTGG - Intronic
950795673 3:15509091-15509113 AATGCAAAGCGGCAGCAGATGGG + Intronic
952694735 3:36251465-36251487 AAACCCAACCTACAACTGATTGG + Intergenic
953102189 3:39841096-39841118 AAACCAAACCTACATTTGATTGG - Intronic
954856242 3:53646243-53646265 TATCCCAACCTGCAGCTTCTTGG - Intronic
955644379 3:61121100-61121122 AGACCAAACCTACAACTGATTGG + Intronic
956157758 3:66316752-66316774 AAACCAAACCTACAGCTGATGGG - Intronic
956655315 3:71544551-71544573 AATCCAAACCTGAAGCACTTGGG + Intronic
957593147 3:82225890-82225912 AATGCAGAGCTGCAGCTGACTGG + Intergenic
960680004 3:120237950-120237972 AGACCAAACCTACAACTGATTGG - Intronic
961008786 3:123422742-123422764 AGACCAAGCCTGCTGCTGATGGG - Intronic
962064535 3:131964729-131964751 AAACCAAACCTACAATTGATTGG + Intronic
962238272 3:133728290-133728312 AGACCAAATCTGCATCTGATTGG - Intergenic
966655909 3:182358577-182358599 AAACCAAACCTGCTGCTCTTTGG + Intergenic
967373800 3:188778496-188778518 AATCCAACCCTGCTGTAGATAGG + Intronic
968437013 4:598563-598585 AGACCAAACCTACAGCTGAGTGG - Intergenic
969385069 4:6839233-6839255 AATCTAAACCTGACGGTGATGGG - Intronic
970021374 4:11573271-11573293 AAAACAAACCAACAGCTGATGGG - Intergenic
970309880 4:14771152-14771174 ACTCCCAGCCTGCAGCTGAAGGG - Intergenic
971285882 4:25289730-25289752 AGACCAAACCTACAACTGATTGG - Intergenic
972376662 4:38477969-38477991 AGACCAAATCTGCATCTGATTGG + Intergenic
973009446 4:45053047-45053069 AGACCAAATCTGCATCTGATAGG + Intergenic
973361972 4:49174440-49174462 AGACCAAATCTGCATCTGATTGG - Intergenic
973399119 4:49622419-49622441 AGACCAAATCTGCATCTGATTGG + Intergenic
973731588 4:53828268-53828290 AGACCAAATCTGCATCTGATTGG - Intronic
974539651 4:63217964-63217986 AGACCAAACCTACAACTGATTGG - Intergenic
975092689 4:70422544-70422566 AGACCAAACCTACATCTGATTGG - Intergenic
976655769 4:87487729-87487751 AGACCAAACCTACATCTGATTGG - Intronic
977164492 4:93678282-93678304 AGACCAAATCTGCATCTGATTGG + Intronic
977199675 4:94100405-94100427 AGACCAAATCTGCATCTGATTGG + Intergenic
977324132 4:95553637-95553659 AATGTAAACCTGGAGCTGCTGGG - Intergenic
977774569 4:100901936-100901958 AAACCAAACCTACATTTGATTGG + Intergenic
978287163 4:107093253-107093275 AAACAAAACCTACAGCTTATTGG - Intronic
978432394 4:108646393-108646415 AATCAAAACTAGCAGCTTATTGG + Intergenic
978663050 4:111151677-111151699 AGACCAAATCTGCATCTGATTGG - Intergenic
979640021 4:123002941-123002963 AGACCAAATCTGCATCTGATTGG - Intronic
979706194 4:123722881-123722903 AGACCAAATCTGCATCTGATTGG + Intergenic
979758568 4:124372566-124372588 AAACCAAATCTGCAACTCATTGG - Intergenic
981273327 4:142869219-142869241 AAACCAAACCTACATTTGATTGG + Intergenic
981419831 4:144536864-144536886 AGTCCAAACATGCAGCTTTTAGG + Intergenic
981554339 4:145976791-145976813 AACTCAACCCTGCAGCTGTTAGG + Intergenic
981607667 4:146557557-146557579 AAACCAAATCTACATCTGATTGG - Intergenic
982189211 4:152836157-152836179 GATACAAACCTGCAGTTGACGGG + Intronic
982859684 4:160433589-160433611 AAACCAAACCTGCAACTGATAGG - Intergenic
983292151 4:165820378-165820400 AGACCAAATCTGCATCTGATTGG + Intergenic
984324007 4:178228404-178228426 AATCAAACCCAGCAGCTGAAAGG + Intergenic
985105511 4:186495708-186495730 ATTCCAAACCTCAACCTGATCGG - Intronic
1202759313 4_GL000008v2_random:95905-95927 AGACCAAATCTGCATCTGATTGG - Intergenic
985826034 5:2192227-2192249 AGTGCAAACCTGCAGCAGAAAGG - Intergenic
986256522 5:6105487-6105509 TACCCAAACCTGCAGCAGCTAGG + Intergenic
986357385 5:6942224-6942246 AATCCAAACCTGGTCCAGATAGG - Intergenic
986648097 5:9938268-9938290 AGACCAAACCTGCATTTGATGGG + Intergenic
987260561 5:16197906-16197928 AGACCAAACCTACAACTGATTGG + Intergenic
988019623 5:25606524-25606546 AATCCAAACATTTAGATGATGGG - Intergenic
989968058 5:50488621-50488643 AGACCAAACCTACATCTGATTGG - Intergenic
990179320 5:53142565-53142587 AGACCAAATCTGCATCTGATTGG + Intergenic
993462280 5:88198295-88198317 AATCAAAAACTGAAGCTGGTTGG + Intronic
994440429 5:99796358-99796380 TATCCAGACCTCCAGGTGATTGG - Intergenic
994951988 5:106475287-106475309 AATCTAATGCTACAGCTGATTGG - Intergenic
994983268 5:106903677-106903699 AGACCAAATCTGCATCTGATTGG - Intergenic
995467411 5:112465370-112465392 AGACCAAACCTGCATCTGAATGG - Intergenic
995800418 5:115988041-115988063 ACTCCAAACCAGCAGCTAAATGG - Intronic
996355980 5:122597170-122597192 AGACCAAATCTGCATCTGATTGG - Intergenic
998605702 5:143632541-143632563 AATCCCAACTTGAAGCTGGTTGG - Intergenic
999143165 5:149376271-149376293 AATCCAAACCTCCAGCGGTGAGG - Intronic
999897892 5:156054229-156054251 AATCCAAACATCCAGATGTTTGG - Intronic
1002216456 5:177638181-177638203 AGACCAAACCTGCATCTGACTGG - Intergenic
1002900916 6:1408911-1408933 AATCCACACCCTCAGATGATCGG - Intergenic
1003815996 6:9840654-9840676 AAGGCAAACCTGCCGTTGATGGG + Intronic
1005106751 6:22232008-22232030 AACCCACACCTGCAGCAGCTGGG + Intergenic
1005239302 6:23805419-23805441 AGACCAAATCTACAGCTGATTGG + Intergenic
1005274345 6:24200015-24200037 AGACCAAACCTACAACTGATTGG + Intronic
1005846245 6:29781255-29781277 AGACCAAATCTGCATCTGATTGG + Intergenic
1005918894 6:30380986-30381008 CATTCAATCCTACAGCTGATTGG - Intergenic
1005976603 6:30804884-30804906 AATCCCAACTTGAAGCTGGTGGG - Intergenic
1006255437 6:32829020-32829042 ATTCCAGTCCTGCAGCTGAAGGG + Intronic
1007974277 6:46084910-46084932 AGACCAAATCTGCATCTGATTGG - Intergenic
1008020988 6:46576851-46576873 AAACCAAACCTACAACTTATTGG + Intronic
1008254301 6:49277267-49277289 AGACCAAACCTACATCTGATTGG + Intergenic
1008544386 6:52573003-52573025 AAACCAAACCTACAAATGATAGG + Intronic
1008586821 6:52958233-52958255 AATCCCAACTTGAAGCTGATTGG - Intergenic
1009632113 6:66213380-66213402 AAAGGAAACCTCCAGCTGATGGG - Intergenic
1010140337 6:72607018-72607040 AATCTCTACCTGCAGCTTATTGG - Intergenic
1010282836 6:74040451-74040473 AAACCAAACCTACAACTGATTGG - Intergenic
1011015487 6:82749651-82749673 AATTCAAACCTGCAGAACATTGG - Intergenic
1011081771 6:83497152-83497174 AGACCAAATCTGCATCTGATTGG + Intergenic
1012554865 6:100499086-100499108 AGACCAAACCTGCATTTGATTGG + Intergenic
1012976594 6:105786768-105786790 AATCCAAACTTGGAGCAGAAGGG - Intergenic
1016340736 6:143059825-143059847 AATCCGAACCTGCAACTGGTTGG + Intergenic
1016790609 6:148063645-148063667 AAACCAAACCTACAACTGATTGG - Intergenic
1021509446 7:21419839-21419861 AATCAATGCCTGCAGCTGCTAGG + Intergenic
1022844013 7:34191809-34191831 AATCCATATCTGCAGCTCAGTGG + Intergenic
1024671354 7:51598638-51598660 AGACCAAATCTGCATCTGATTGG - Intergenic
1025582792 7:62741414-62741436 AAACCAAATCTACATCTGATTGG - Intergenic
1025714610 7:63943088-63943110 AAACCAAACCTACAATTGATTGG + Intergenic
1028644306 7:93077866-93077888 AGACCAAACCTACAACTGATTGG + Intergenic
1028799665 7:94948412-94948434 AATAGAAACCTCCAGCTGCTAGG - Intronic
1031266466 7:119588075-119588097 AGACCAAATCTGCATCTGATTGG + Intergenic
1031344587 7:120650252-120650274 AGACCAAATCTACAGCTGATTGG - Intronic
1031635663 7:124098728-124098750 AGACCAAATCTGCATCTGATTGG - Intergenic
1031728990 7:125274452-125274474 AATCCAATCATGCAGTTTATGGG + Intergenic
1033067883 7:138173320-138173342 AACCCCAACTTGAAGCTGATTGG + Intergenic
1033661798 7:143407996-143408018 GTTCCAATCCTGCAGCTGATGGG - Intronic
1033977040 7:147115453-147115475 AAACTAAACCTTCAACTGATTGG - Intronic
1034549886 7:151813764-151813786 AATCCAAAGAAGCAGCAGATGGG - Intronic
1034783909 7:153907639-153907661 TATCCAGACCTCCAACTGATTGG - Intronic
1035791697 8:2312087-2312109 AATCTAAGGCTGCCGCTGATCGG + Intergenic
1035801108 8:2409618-2409640 AATCTAAGGCTGCCGCTGATCGG - Intergenic
1040040976 8:42916668-42916690 AATCCACACCTGTAGCTTAAAGG + Intronic
1043223706 8:77698332-77698354 AGACCAAACCTTCAACTGATAGG - Intergenic
1044798826 8:95932524-95932546 AGACCAAATCTGCATCTGATTGG - Intergenic
1045408625 8:101892868-101892890 AAACCAAATCTACATCTGATTGG + Intronic
1046014771 8:108591573-108591595 AAGCCAAACCTACAATTGATTGG + Intergenic
1046476434 8:114750754-114750776 AATTCACATCTGCTGCTGATAGG + Intergenic
1046536130 8:115513251-115513273 AATCCCAAACTGCAGCAGAAGGG + Intronic
1048940208 8:139393967-139393989 GATACAAACCTGCAGCTCAAAGG + Intergenic
1050049817 9:1588020-1588042 ATACCAAATCTGCATCTGATCGG - Intergenic
1051303198 9:15676008-15676030 AGACCAAACCTGCATTTGATTGG - Intronic
1051843739 9:21428257-21428279 AGTCCAAACCTACAACTGATTGG - Intronic
1052038059 9:23705717-23705739 AATCTAATGCTGCAGCTAATCGG + Intronic
1052632596 9:31060705-31060727 AGACCAAACCTGCATCTGATTGG - Intergenic
1052743954 9:32421482-32421504 AATCCAACCCTGCAACTGCCTGG + Intronic
1053678863 9:40465984-40466006 AGACCAAACCTACAACTGATTGG + Intergenic
1053928848 9:43094337-43094359 AGACCAAACCTACAACTGATTGG + Intergenic
1054284862 9:63158958-63158980 AGACCAAACCTACAACTGATTGG - Intergenic
1054291941 9:63301522-63301544 AGACCAAACCTACAACTGATTGG + Intergenic
1054389959 9:64606065-64606087 AGACCAAACCTACAACTGATTGG + Intergenic
1054505755 9:65910311-65910333 AGACCAAACCTACAACTGATTGG - Intergenic
1056280207 9:85034477-85034499 AATACAAACCTGCAGCTCCCAGG - Intergenic
1059675580 9:116535992-116536014 AGACCAAACCTACATCTGATTGG - Intronic
1059708212 9:116843193-116843215 AATCCAATCCACCAGTTGATGGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1203374075 Un_KI270442v1:348466-348488 AAACCAAATCTACATCTGATAGG - Intergenic
1203554600 Un_KI270743v1:195039-195061 AGACCAAATCTGCATCTGATTGG + Intergenic
1186775712 X:12862931-12862953 AGACCAAATCTGCATCTGATTGG - Intergenic
1186956440 X:14687440-14687462 AGACCAAATCTGCATCTGATTGG - Intronic
1188084290 X:25883839-25883861 AATCCAAATCTACATTTGATTGG + Intergenic
1188638175 X:32462378-32462400 AAAGCAAAACTGCAGATGATCGG + Intronic
1189216769 X:39331944-39331966 TATTCAAACCATCAGCTGATTGG - Intergenic
1189685879 X:43563103-43563125 AATTCAGGCCTTCAGCTGATTGG - Intergenic
1191072807 X:56420271-56420293 AGACCAAACCTACATCTGATTGG - Intergenic
1191627459 X:63283995-63284017 AATCCAGAGCCACAGCTGATTGG - Intergenic
1191643221 X:63450993-63451015 AAACCAAATCTACATCTGATTGG - Intergenic
1192376593 X:70569042-70569064 AGACCAAATCTGCATCTGATTGG - Intronic
1192997905 X:76532042-76532064 ACACCAAACCTACAACTGATTGG - Intergenic
1194191104 X:90837714-90837736 AAACCAAATCTACATCTGATTGG + Intergenic
1194243411 X:91479627-91479649 AGACCAAACCTGCAACTCATTGG - Intergenic
1194368086 X:93034052-93034074 AGACCAAATCTGCATCTGATTGG + Intergenic
1194782983 X:98047987-98048009 AGACCAAACCTGCATTTGATTGG - Intergenic
1196367664 X:114941850-114941872 AGACCAAACCTACATCTGATTGG - Intergenic
1196570632 X:117262163-117262185 AGACCAAATCTGCATCTGATTGG + Intergenic
1197384469 X:125786432-125786454 AAGCCAGAACTGCAGCTGCTTGG + Intergenic
1197624231 X:128784016-128784038 AAACCAAATCTGCGTCTGATTGG + Intergenic
1197927067 X:131657682-131657704 AAACCAAACCTACATTTGATTGG + Intergenic
1199114127 X:143970053-143970075 AATCCATGCTGGCAGCTGATTGG + Intergenic
1200537757 Y:4420129-4420151 AAACCAAATCTACATCTGATTGG + Intergenic
1200562394 Y:4721002-4721024 AGACCAAACCTGCAACTCATTGG - Intergenic
1200574213 Y:4867857-4867879 AGACCAAATCTGCATCTGATTGG + Intergenic
1200676287 Y:6150312-6150334 AGACCAAATCTGCATCTGATTGG + Intergenic
1202386407 Y:24330816-24330838 CATCCAAGCCAGCAGCTGCTAGG + Intergenic
1202484379 Y:25339312-25339334 CATCCAAGCCAGCAGCTGCTAGG - Intergenic
1202602051 Y:26603268-26603290 AAACCAAATCTGCGTCTGATTGG + Intergenic