ID: 1146891604

View in Genome Browser
Species Human (GRCh38)
Location 17:36510003-36510025
Sequence TTCCCCCAGCAGAGCTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146891598_1146891604 17 Left 1146891598 17:36509963-36509985 CCTCAGCTGCCCTGGACCATTTT 0: 1
1: 0
2: 2
3: 31
4: 269
Right 1146891604 17:36510003-36510025 TTCCCCCAGCAGAGCTTCTCAGG 0: 1
1: 0
2: 2
3: 20
4: 218
1146891601_1146891604 7 Left 1146891601 17:36509973-36509995 CCTGGACCATTTTCAACTCGGAC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1146891604 17:36510003-36510025 TTCCCCCAGCAGAGCTTCTCAGG 0: 1
1: 0
2: 2
3: 20
4: 218
1146891600_1146891604 8 Left 1146891600 17:36509972-36509994 CCCTGGACCATTTTCAACTCGGA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1146891604 17:36510003-36510025 TTCCCCCAGCAGAGCTTCTCAGG 0: 1
1: 0
2: 2
3: 20
4: 218
1146891602_1146891604 1 Left 1146891602 17:36509979-36510001 CCATTTTCAACTCGGACGATCTG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1146891604 17:36510003-36510025 TTCCCCCAGCAGAGCTTCTCAGG 0: 1
1: 0
2: 2
3: 20
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146891604 Original CRISPR TTCCCCCAGCAGAGCTTCTC AGG Intronic
900108969 1:997763-997785 TCCCCCCAGCAGTCCTACTCTGG - Intergenic
900791713 1:4685043-4685065 CTCTCCCAGCAGGGCTTCTCTGG + Intronic
900970379 1:5989388-5989410 CTCCCCCAGGAGGGCTTCCCAGG + Intronic
902530328 1:17086564-17086586 TTCCCCGACGAGGGCTTCTCAGG - Exonic
905207754 1:36352633-36352655 TTCCCCCTGCAGAGCATAGCAGG + Intronic
905228456 1:36495092-36495114 CCCGCCCAGCAGAGCTTCACGGG + Intergenic
905243813 1:36598577-36598599 TTCCCCCATCACAGCTACCCAGG + Intergenic
908572625 1:65425252-65425274 TTCCCACAGTAGAGGTTGTCAGG - Intronic
910115210 1:83724267-83724289 TTCCCCCAGTAGTGCTAGTCTGG - Intergenic
911038257 1:93572215-93572237 TTCCCCGAGGAGAGATTCTCAGG - Intronic
911879474 1:103217052-103217074 TTCCTCGAGCAGAGCTTCCGGGG - Intergenic
915627906 1:157127064-157127086 TGGCCCAAGCAGAGCTTCTCTGG - Intronic
916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG + Intergenic
916731093 1:167567431-167567453 TTCCCACTGCAGGGCTTCTCTGG + Intergenic
918366926 1:183817924-183817946 TTCCCACAGAAGTGTTTCTCAGG + Intronic
920024900 1:202987188-202987210 TTCTCCCACCTGAGCATCTCTGG - Intergenic
920045587 1:203130157-203130179 CACCCCCGGCATAGCTTCTCTGG + Intronic
921917381 1:220627601-220627623 TTCACCCAGCATAGCTGCCCTGG - Intronic
924612875 1:245588477-245588499 TTCCTCCAGCTGGGCTTCACTGG + Intronic
1063507227 10:6610987-6611009 TTCCTTCAGCAGAGCTTAGCAGG - Intergenic
1068677161 10:59780026-59780048 ATCGCCCAGCGGAGCTCCTCAGG + Intergenic
1068854158 10:61780368-61780390 TTCCTGCAGCAGAGCAACTCTGG + Intergenic
1074548509 10:114421191-114421213 TTCTATCAGCAAAGCTTCTCTGG - Intergenic
1075743618 10:124711058-124711080 TTCACCCAGCAAAGCGTCTGTGG - Intronic
1075945387 10:126428515-126428537 TTCCCCCAGCTGGTCTCCTCTGG - Intronic
1076042695 10:127264766-127264788 TCCTCCCAGCTGAGCTTCCCAGG + Intronic
1076108603 10:127844613-127844635 TCCCCCAACCAGAGCTTCTCTGG + Intergenic
1076135924 10:128045735-128045757 TGCCCACAGCAGAGCTTCCCTGG - Intronic
1076497385 10:130905856-130905878 TGCCACCAGCAGCCCTTCTCTGG + Intergenic
1076888809 10:133274303-133274325 CCCCCCCAGCTGAGCTTCTCTGG - Intronic
1077278552 11:1730364-1730386 TTCCACCATCACAGCCTCTCTGG + Intergenic
1080054565 11:27892768-27892790 TTCCCTCAGCAGAGCTTCCTAGG + Intergenic
1080592446 11:33736017-33736039 TTCCCCCGGCGCAGTTTCTCTGG + Intronic
1081366138 11:42237788-42237810 TTCTCACAGAAGAGCTTCTAGGG + Intergenic
1081958165 11:47111787-47111809 TTCCCTAAGCAGAGCTAGTCTGG - Intronic
1082950029 11:58804828-58804850 TTCCACCTCCAGGGCTTCTCAGG - Intergenic
1084462596 11:69304178-69304200 TTCCCCCATCAGGGAATCTCTGG - Intronic
1085577730 11:77621886-77621908 TTCTGCCAGCAGAACTTCTGAGG + Intronic
1087076888 11:94133881-94133903 TTCCCTCAGCACAGCCACTCTGG - Intronic
1088973897 11:114797603-114797625 TTGTCTCAGCAGAGCTTCCCTGG + Intergenic
1091142208 11:133244903-133244925 CTCCCCCCTCAGACCTTCTCAGG - Intronic
1095630274 12:44368105-44368127 ATCCTCCTCCAGAGCTTCTCAGG + Intronic
1097234553 12:57530364-57530386 GTCCCCCAACACAGCTTCTGTGG - Exonic
1097935787 12:65249691-65249713 TGCCCCTAGTAGAGGTTCTCAGG - Intergenic
1101058391 12:100944502-100944524 TTCCCCCAAAAGTTCTTCTCTGG + Intronic
1102547277 12:113666037-113666059 TGCCCCCAGCCGGCCTTCTCGGG + Intergenic
1103484551 12:121273982-121274004 TGCCCCCAGCAGGGCCTCTGTGG - Intronic
1103837342 12:123833246-123833268 TTCAACCTGCAGAGCATCTCAGG + Exonic
1103942067 12:124506577-124506599 CTCCCCGTGCAGGGCTTCTCGGG - Intronic
1104284848 12:127415717-127415739 TTCCCACAGGAGATGTTCTCTGG + Intergenic
1104729775 12:131098349-131098371 TTCCCCCACCATGGCTTCTGAGG - Intronic
1110876102 13:80512238-80512260 TTCCCCAGGCAGAGCTTCCTTGG + Intergenic
1116302374 14:43200415-43200437 ATGCCCAAGCAGAACTTCTCAGG + Intergenic
1118484100 14:66197490-66197512 TTCCCCAAGAAGAGCAGCTCTGG + Intergenic
1120625252 14:86817701-86817723 TGGCCCCAGAAGAGCTTGTCAGG - Intergenic
1121604927 14:95233728-95233750 TTCTGCCAGCAGAGCCTCTTAGG - Intronic
1121690558 14:95875242-95875264 TTCCCCCAGCTCTGCTTCTGAGG + Intergenic
1122206779 14:100151610-100151632 CTGCTCCAGCAAAGCTTCTCTGG - Intronic
1122430249 14:101635698-101635720 TTCCTCCAGCCCAGCTTCCCTGG + Intergenic
1122569230 14:102683564-102683586 TTCCACCAGCGGGGCTTCCCCGG + Intronic
1122809851 14:104282477-104282499 CTCCCCCAGCAGAGAGTCTTAGG - Intergenic
1124396358 15:29305480-29305502 CACCTCCAGCACAGCTTCTCTGG - Intronic
1125578153 15:40768763-40768785 TTCCCACCGCAGACCTTATCAGG - Intronic
1125993138 15:44129947-44129969 TTCCCCAAGCTGATGTTCTCTGG - Intronic
1127097528 15:55527482-55527504 GGCCCCCAGCACAGCTTCCCAGG - Intergenic
1127334932 15:57974933-57974955 TTGCCACAGCATATCTTCTCTGG - Intronic
1129521223 15:76187457-76187479 CTCCCCCAGCAGAGCTTGGGAGG + Intronic
1130575792 15:85092241-85092263 TTCCCCTGGCAGGGCTTCACTGG - Intronic
1130651852 15:85766536-85766558 CGCCCCCAGCTCAGCTTCTCAGG + Intronic
1130936288 15:88473652-88473674 TCCCCCTACCAGAGCTTCTAGGG - Intronic
1132643926 16:990211-990233 TTCCCCCAGCAGTGCCCCCCAGG + Intergenic
1132842423 16:1984538-1984560 GTACCCCGGCAGAGCTTCCCAGG + Intronic
1133256355 16:4518866-4518888 TTCCCACAGCAGAGGTGCTGGGG - Intronic
1133301964 16:4787948-4787970 TTCCCCCAGCAGAGCCTGGAGGG + Intronic
1134291381 16:12904512-12904534 TTCCCCCAGCAGAGCTGCACGGG - Intronic
1136075026 16:27811387-27811409 TTCCATCAGCAGAGGTGCTCAGG + Intronic
1137871190 16:51951997-51952019 TTCCCCCAACAGAGCTGATAAGG - Intergenic
1138406118 16:56795608-56795630 TTCCTCCAGCACAGCCTCTCAGG - Intronic
1139505801 16:67397571-67397593 TTCCCCCAGCAAAGCCTGCCCGG + Intronic
1140877095 16:79162764-79162786 CTCCCCCAGCACAGCTTCCAGGG - Intronic
1140958673 16:79891718-79891740 TTCCCATAGAAGAGCTTCTGTGG + Intergenic
1141641555 16:85344461-85344483 TTGTCCCATCACAGCTTCTCAGG - Intergenic
1142713100 17:1733952-1733974 ATCCGCCTGCAGAGCTTCCCGGG + Exonic
1143166715 17:4900575-4900597 GTCCCCCAAGAGAGCTACTCGGG + Exonic
1146179973 17:30691699-30691721 TTCCCCCACCTCAGCTTCCCAGG - Intergenic
1146891604 17:36510003-36510025 TTCCCCCAGCAGAGCTTCTCAGG + Intronic
1146913528 17:36663590-36663612 GTGCCCCCCCAGAGCTTCTCTGG + Intergenic
1147921073 17:43917474-43917496 TTCACCCAGAAGGACTTCTCTGG + Exonic
1148085613 17:44992020-44992042 TTCCCCCAGCCCCGCTTCCCAGG - Intergenic
1148131171 17:45263398-45263420 TTCTCCCAGGGGAGCTACTCAGG - Exonic
1149691968 17:58585042-58585064 TTCCTCCAGCATAGACTCTCTGG + Intronic
1150453657 17:65289797-65289819 TTTCCACCGCAGAACTTCTCAGG - Intergenic
1151825796 17:76523512-76523534 TTCCCCCAGCAAGGCCTCTGGGG + Intergenic
1151867303 17:76812514-76812536 TCCCCACAACAGTGCTTCTCAGG - Intergenic
1151971418 17:77459353-77459375 TTCACCCAGCAGTGCTTTTTGGG + Intronic
1152104983 17:78323517-78323539 TTCCCCCAGCAGAGCCAGCCTGG - Intergenic
1155314531 18:24558394-24558416 TGCCCCCAGCCGAATTTCTCTGG + Intergenic
1156522630 18:37734663-37734685 TTCCCTGAGCAAAGCTTCCCAGG + Intergenic
1159897491 18:74011315-74011337 TTCCCCCAGGGGAGGTTCTGTGG + Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1162809564 19:13155769-13155791 TTCCACCAGCAGACGTTCTGAGG - Intergenic
1162811234 19:13165274-13165296 TTCCCCCAACATGACTTCTCAGG - Intergenic
1165026551 19:32966695-32966717 TTCCCTCCTCAGAGCTTCCCTGG + Intronic
1165056881 19:33183140-33183162 ATTCCTCAGCAGAGCTTCTCTGG + Intronic
1165157919 19:33798985-33799007 CTCCCCCAGCAGAGCCTCCTAGG + Intronic
1165832058 19:38735287-38735309 TTCCCCCACCCCAGCATCTCAGG - Intronic
1166951594 19:46432057-46432079 TTGCCCCCACAGAGCTGCTCCGG - Intergenic
1167457895 19:49607598-49607620 TTCTCCCACCTGAGCCTCTCAGG - Intronic
1168238794 19:55079076-55079098 TTCCCCCAGGACATCTTCTGGGG + Intronic
926198313 2:10776686-10776708 GTCCCCCAGCAGGGCCTCCCTGG - Intronic
927206356 2:20613479-20613501 TTCCTCCAGCAGTGCCCCTCTGG - Intronic
927362317 2:22250243-22250265 TTGGCCCAGCAGTGATTCTCTGG + Intergenic
928098332 2:28419519-28419541 TTCCCCCAACAGACCGTCTTAGG - Intergenic
928509921 2:31993672-31993694 TTTCCCCAGAAGAGTTTCTTTGG - Intronic
929962939 2:46510030-46510052 TGCCCTCAGCAGAGCATCTTGGG + Intronic
930087883 2:47510849-47510871 TTCACCCAGCTGTACTTCTCCGG - Intronic
930933659 2:56919909-56919931 TTCTCCCAGCAGAGCTTCCAGGG + Intergenic
932294912 2:70616248-70616270 TTCCTCCTGGAGAGCTTTTCTGG + Intronic
933297790 2:80509918-80509940 TTCCCCCTGGAGAAATTCTCAGG + Intronic
935671706 2:105561794-105561816 TGCCCCCAGCTCAGCTCCTCTGG - Intergenic
936403115 2:112181461-112181483 TTGCCCCAGCTGTCCTTCTCGGG + Intronic
937975736 2:127581183-127581205 CTCACCCCGCAGGGCTTCTCCGG + Intronic
938657592 2:133450280-133450302 TTCTCCCAGCAATTCTTCTCTGG + Intronic
938950668 2:136251645-136251667 TTCCCATAGCACTGCTTCTCAGG - Intergenic
939341949 2:140907918-140907940 TTCCCATTGCAGAGTTTCTCTGG + Exonic
941202728 2:162532667-162532689 TTCCCCAAACACAGCTTCTTAGG - Intronic
941677330 2:168357497-168357519 TTCCCATAGCAGTGCTTCTGTGG - Intergenic
942338628 2:174919011-174919033 TTCCCTCACCACAGCTTATCAGG + Intronic
942883970 2:180899680-180899702 GTCTCCCAGCAGAGCCTCTTGGG - Intergenic
944908802 2:204288876-204288898 TTTCCACAGGACAGCTTCTCTGG - Intergenic
945003672 2:205378550-205378572 TTACCCAGGCACAGCTTCTCAGG + Intronic
946010160 2:216558069-216558091 TTGCCCCAGCAGAGGGCCTCTGG - Intronic
947025609 2:225734594-225734616 TTCCCCCAAGAGTCCTTCTCTGG - Intergenic
1169441560 20:5638020-5638042 CTCCTCCAGCTCAGCTTCTCAGG - Intergenic
1170059781 20:12246922-12246944 TTCCTTGAGCTGAGCTTCTCTGG - Intergenic
1172015707 20:31871137-31871159 TGGTCCCAGCAGAGCTTCCCTGG - Exonic
1172122416 20:32606269-32606291 TTCCTCCTGCACAGCTCCTCCGG + Intronic
1172248210 20:33460644-33460666 TTCTCCCAGCAGAGCTTCGGAGG - Intergenic
1172996327 20:39072606-39072628 TCCCCCCAACACAGCCTCTCAGG - Intergenic
1173248208 20:41350373-41350395 TTCCCCCTGGAGACCCTCTCTGG - Exonic
1173472071 20:43332027-43332049 TTCCTCCAGCAAAGATTCTTTGG - Intergenic
1174787139 20:53443697-53443719 TTCTCCCAGCAGAGCTACTTGGG - Intronic
1175286920 20:57843096-57843118 TTCCCCCTGGAGAGGTTCTGAGG + Intergenic
1175665083 20:60851926-60851948 GTCCCCTACCTGAGCTTCTCAGG + Intergenic
1175935726 20:62513083-62513105 CTGCCCCGGCAGAGCTCCTCGGG - Intergenic
1177322524 21:19541706-19541728 ATCTCCCAGCAGGGCTTGTCTGG + Intergenic
1178750057 21:35294246-35294268 TTGCGCCAGAAGAGCTTGTCTGG + Intronic
1179187405 21:39095612-39095634 TTTGACCACCAGAGCTTCTCTGG + Intergenic
1179294136 21:40045518-40045540 TTCCACCAGCAGAGACTGTCAGG + Intronic
1179796974 21:43790502-43790524 TTCCTGCAGCAGTGGTTCTCAGG - Intronic
1180002493 21:45001653-45001675 TTGCCCCAGCTCAGCATCTCGGG - Intergenic
1180122724 21:45764883-45764905 TTCCAAGAGCAAAGCTTCTCCGG - Intronic
1181635362 22:24171967-24171989 TACCCCCAGCATGGCCTCTCTGG + Exonic
1182515755 22:30858003-30858025 TTCCCCCGGCATACTTTCTCCGG - Intronic
1183288700 22:36984403-36984425 TTCCCACAGCACATCCTCTCTGG - Intergenic
1183465372 22:37977732-37977754 TTGCCCCAGCAGAGCTGCAGGGG - Intronic
1184837910 22:47035000-47035022 TGCCCCCAGGAGAGCTTCAGAGG - Intronic
1185189332 22:49424431-49424453 TTCTCCAAGCTGAGCTTCTCAGG + Intronic
950615205 3:14152554-14152576 TTTGCCTAGCACAGCTTCTCTGG - Intronic
953364647 3:42333373-42333395 TTCCTCCCACAGAGCTTTTCTGG - Intergenic
953458347 3:43061747-43061769 TTGCCTCAGCAGAGCCTCTGAGG - Intergenic
954076093 3:48182050-48182072 TTCCCCCGAAATAGCTTCTCAGG - Intronic
954465249 3:50650593-50650615 TGCACCCAGCACAGCATCTCAGG - Intergenic
955221353 3:57025925-57025947 TTTCCCCAGGAGTGCTTCTGGGG - Intronic
956282803 3:67576113-67576135 TTTCCACAGCAGAGTTTCTGTGG + Intronic
960693037 3:120367390-120367412 TTCCCCCATCAGAGACTTTCAGG + Intergenic
960949302 3:122988713-122988735 TTCTCCCAGCAGAGCTTTCCAGG - Intronic
962367546 3:134796208-134796230 ATACCACGGCAGAGCTTCTCCGG - Intronic
964920195 3:161886457-161886479 TGCCCTCACCACAGCTTCTCAGG - Intergenic
967266880 3:187699065-187699087 TTTCCCTCTCAGAGCTTCTCAGG - Intronic
970006819 4:11418958-11418980 CTGCCTCAGCAGAGCTTCTGAGG - Intronic
971358199 4:25913656-25913678 ATCCCCCAGCAGGCCCTCTCGGG + Intronic
972316997 4:37935986-37936008 TTCCCCCAGGAGGCCTTCTCTGG + Intronic
972809014 4:42562378-42562400 GTCCCCCAGGAGAGCCTCTAAGG - Intronic
975544590 4:75548123-75548145 CTCCCCCAACAAAGCTGCTCTGG + Intronic
976805327 4:89039826-89039848 TCCTCCCACCACAGCTTCTCAGG + Intronic
983687545 4:170429314-170429336 TTCCACCAGCACAGCAGCTCAGG - Intergenic
983692015 4:170482056-170482078 TTGCCCCAGCTGTGCTTCCCTGG - Intergenic
986650358 5:9957618-9957640 TTCACCCAGCACTGCTCCTCTGG - Intergenic
988482191 5:31639709-31639731 TACCCCCGGCAGTGCGTCTCCGG - Intronic
989134207 5:38136729-38136751 TCCCCCCAGCTTAGCTCCTCTGG - Intergenic
989507650 5:42246070-42246092 TTCCCCCAGAAAGCCTTCTCTGG + Intergenic
990649177 5:57878825-57878847 TCCTCCCACCACAGCTTCTCAGG + Intergenic
990676764 5:58195433-58195455 TCCCCACAGCAGAGGTTCTCTGG - Intergenic
992591058 5:78295748-78295770 TTCCCCCAGCCCGCCTTCTCAGG + Intergenic
992660037 5:78950314-78950336 TTTCCTCAGCCCAGCTTCTCTGG - Intronic
994139391 5:96325095-96325117 TTCTCCCACCTCAGCTTCTCAGG - Intergenic
994450419 5:99934433-99934455 TCCCCCCAGCAGACTTTTTCTGG - Intergenic
996245150 5:121254351-121254373 TTGCCCCAGCTGACCTTCTGTGG + Intergenic
999133026 5:149299196-149299218 AGCCCCGAGCAGAGGTTCTCAGG - Intronic
999306972 5:150525793-150525815 GGCCCCCAGGAGAGCTGCTCAGG - Intronic
999690313 5:154140755-154140777 TTCCTCCAGATGACCTTCTCTGG + Intronic
1000342664 5:160289533-160289555 TTCCCCCAGAATGGCTCCTCTGG - Intronic
1000981080 5:167817839-167817861 TGCCCCCAGCAGAGCTGGGCTGG - Intronic
1001670516 5:173469586-173469608 TTCCACCTGCAGCCCTTCTCGGG + Intergenic
1002525114 5:179811298-179811320 TCCCCCCTGCAGAGCTTCTGTGG - Intronic
1003651925 6:7968759-7968781 TGTCCCCAGAAGAGCTTCTGGGG - Intronic
1005175507 6:23040237-23040259 TTCCCCCACCTCAGCTTCACAGG + Intergenic
1005415785 6:25599048-25599070 GTCCCCCAGCTCAGCTTCTTTGG + Intronic
1007473966 6:42107062-42107084 TTGGCTCAGCAGGGCTTCTCGGG + Exonic
1007959165 6:45942973-45942995 TTCCCCCTCCACTGCTTCTCTGG + Intronic
1008818651 6:55603624-55603646 TTCCCCAAGAAGACCTTCTGTGG - Intergenic
1009298921 6:61990155-61990177 TTCCCCCAGCAGAGGGACTGTGG - Intronic
1012273485 6:97243842-97243864 GTCACCCAGCAGAGCTACTGGGG + Intronic
1012852591 6:104464837-104464859 TTCACCCAGCATAGCTTCAGTGG + Intergenic
1013790449 6:113830361-113830383 TTCACCAGGCAGAGCTTCTTTGG + Intergenic
1017490903 6:154944448-154944470 TTGCCCCTGCAGAGATTCTGTGG + Intronic
1018952415 6:168387747-168387769 TGTCCCCAGCAGAGCTTCTCAGG + Intergenic
1020502317 7:8938875-8938897 GTCCCTCAACAGAGTTTCTCAGG - Intergenic
1024473332 7:49785965-49785987 TGCCCCCAGCTGAGCTCCACTGG - Intronic
1024786651 7:52914776-52914798 TTCCATCAGCATAGCTTCTTTGG + Intergenic
1026003733 7:66583687-66583709 TTCTCCCAGCAGAGTTACCCAGG - Intergenic
1026027548 7:66759347-66759369 TTCTCCCAGCAGAGTTGCCCAGG + Intronic
1026333500 7:69373626-69373648 TACCTACAGCAGAGCTACTCAGG + Intergenic
1026825583 7:73579267-73579289 TTCCCACATCCCAGCTTCTCAGG - Intergenic
1028084241 7:86616992-86617014 TTGCCCTAGGAGAGGTTCTCTGG - Intergenic
1028150836 7:87369463-87369485 TCACCCCGCCAGAGCTTCTCAGG + Exonic
1031288304 7:119900452-119900474 TTGCTCCAGCACAGCATCTCTGG - Intergenic
1034353510 7:150432857-150432879 CTCCCCCACCAGGGTTTCTCGGG - Intergenic
1035721626 8:1797259-1797281 TTCCTCCAGAAGAGCTTTTTTGG + Intergenic
1037804020 8:22049424-22049446 TGCCCCCACCCCAGCTTCTCCGG + Intronic
1037957919 8:23072937-23072959 TCCCTCCAGCACAGCCTCTCTGG - Intergenic
1041465753 8:58156034-58156056 CACCCCCAGCAGAGCTTCCCTGG - Intronic
1045877245 8:106996503-106996525 TTCCCCCTGCAGAGAATATCGGG + Intergenic
1046833824 8:118777510-118777532 CTCCCCAACCAGAGCTTATCTGG + Intergenic
1048537304 8:135309257-135309279 TTCCTCAAGTACAGCTTCTCTGG + Intergenic
1052822453 9:33148371-33148393 TTCCACCAGCAGAGCATGACAGG - Intronic
1054786722 9:69217322-69217344 TTCCCACAGGATAACTTCTCAGG + Intronic
1056553812 9:87672982-87673004 TTCACCCTGCAGAGCATCTTAGG + Intronic
1056558882 9:87712396-87712418 TGCCCACAGCAGAGGTCCTCGGG + Intergenic
1056701741 9:88916924-88916946 CTCCCACAGCAGAGCTTATGTGG - Intergenic
1057258938 9:93573469-93573491 TGCCCCCAGCTCACCTTCTCAGG + Intergenic
1057891708 9:98874714-98874736 GTCCTCCAGGGGAGCTTCTCTGG + Intergenic
1061519957 9:131112029-131112051 CCTCCCCAGCAGAGCGTCTCAGG + Intronic
1061563125 9:131419465-131419487 GTTCCCCAGCAGGGCTGCTCTGG - Intronic
1061678920 9:132232942-132232964 TGCCCCCAGGGGAGCTGCTCTGG - Intronic
1061732759 9:132629116-132629138 TTCACCCAGCGCTGCTTCTCCGG - Intronic
1062665895 9:137671630-137671652 TTCTCCCACCACAGCCTCTCAGG + Intronic
1186995802 X:15120768-15120790 TGGCCTCAGCAGAGCTTCCCCGG - Intergenic
1188723541 X:33551975-33551997 TTAGCACAGCAGAGCTTCTCTGG - Intergenic
1196043811 X:111234739-111234761 TTCCCTGAGTAGAGCTCCTCTGG + Intergenic