ID: 1146891763

View in Genome Browser
Species Human (GRCh38)
Location 17:36510903-36510925
Sequence CCGTCCTGACAGAGTCTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146891758_1146891763 -7 Left 1146891758 17:36510887-36510909 CCCAGCAGCGAGGCTGCCGTCCT 0: 1
1: 0
2: 1
3: 12
4: 115
Right 1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 121
1146891759_1146891763 -8 Left 1146891759 17:36510888-36510910 CCAGCAGCGAGGCTGCCGTCCTG 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 121
1146891757_1146891763 -6 Left 1146891757 17:36510886-36510908 CCCCAGCAGCGAGGCTGCCGTCC 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 121
1146891751_1146891763 22 Left 1146891751 17:36510858-36510880 CCATCTCCAGCAGCACGTCCTCT 0: 1
1: 0
2: 7
3: 32
4: 331
Right 1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 121
1146891755_1146891763 4 Left 1146891755 17:36510876-36510898 CCTCTGGGAGCCCCAGCAGCGAG 0: 1
1: 0
2: 2
3: 23
4: 279
Right 1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 121
1146891754_1146891763 16 Left 1146891754 17:36510864-36510886 CCAGCAGCACGTCCTCTGGGAGC 0: 1
1: 0
2: 3
3: 29
4: 224
Right 1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146891763 Original CRISPR CCGTCCTGACAGAGTCTGGG AGG Exonic
900554732 1:3274625-3274647 CCGACGTGACAGAGCCTGGAAGG - Intronic
901125813 1:6927991-6928013 CTGTCCTGAGAGATTGTGGGAGG - Intronic
901599492 1:10411735-10411757 AAGTCCCCACAGAGTCTGGGTGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
904319059 1:29684756-29684778 CCCACCTTACAGAGTGTGGGAGG + Intergenic
915409364 1:155688611-155688633 CCGGCTTGACAGGGTCTGAGGGG - Exonic
919142493 1:193589908-193589930 CGGTCCAGACTGAGTCTGAGAGG + Intergenic
919741075 1:200982070-200982092 TGGGCCTGGCAGAGTCTGGGGGG - Intronic
922806096 1:228390720-228390742 CTGTCCTGAAAGAGTTTGGGAGG - Intergenic
924129566 1:240891992-240892014 CCGTCCTCTCAGAGTCTCTGGGG - Intronic
1064017477 10:11783795-11783817 CCGCCCTGCCAGAGGCTGGGCGG - Intergenic
1067580626 10:47443371-47443393 ATGTCCAGACACAGTCTGGGGGG + Intergenic
1073138629 10:101233408-101233430 CAGTCCTGACTTAGCCTGGGTGG - Intergenic
1074556621 10:114497277-114497299 CCGTCCTGCCTGAGCCTGAGTGG + Intronic
1075056506 10:119222789-119222811 GTGTCCTGTCAGAGTGTGGGAGG + Intronic
1077458637 11:2697028-2697050 CTTTCCTGAAAGGGTCTGGGGGG - Intronic
1077529944 11:3090379-3090401 CTGCCCTCTCAGAGTCTGGGAGG - Intronic
1081710707 11:45213670-45213692 TCGCCCTTGCAGAGTCTGGGTGG + Intronic
1081853930 11:46292070-46292092 TAGGCCTGACAGGGTCTGGGGGG + Intronic
1084949708 11:72657912-72657934 CCCTGCTCACAGAGGCTGGGTGG - Intronic
1086527170 11:87741292-87741314 CTGGCCTGACAGACTCTTGGAGG - Intergenic
1091370795 11:135056387-135056409 CTGTCCCTACAGAGCCTGGGAGG - Intergenic
1097702368 12:62833174-62833196 CAGTCCTGACAGAGTGAGTGTGG + Intronic
1099992586 12:89740930-89740952 CCGTCCTCACAGAGTGAGTGTGG - Intergenic
1100856462 12:98761852-98761874 CCCTCCTGACCCAGGCTGGGAGG + Intronic
1101519030 12:105464558-105464580 CCCTCCTTTCAGAGTCTGGCTGG + Intergenic
1102012756 12:109628677-109628699 CCCACCTCACAGAGCCTGGGGGG + Intergenic
1102998219 12:117365580-117365602 CCTTCCTGACATTGACTGGGAGG + Intronic
1104965378 12:132506713-132506735 CAGCCCTGACAGATCCTGGGTGG + Intronic
1109261391 13:60149177-60149199 CCTTCCTGACAGAATGTGGATGG + Intronic
1112509753 13:99998454-99998476 CCGCCCTGACAGCGCCTGGTGGG + Intergenic
1113791545 13:113031462-113031484 CTGTAGGGACAGAGTCTGGGAGG + Intronic
1114641006 14:24220833-24220855 CCGTCCTACCTGAGTCTGGCTGG + Intronic
1115645992 14:35368848-35368870 TCTTTCTGGCAGAGTCTGGGAGG - Intergenic
1116104660 14:40486848-40486870 CAGTGCTGACTGAGACTGGGTGG - Intergenic
1119610153 14:76054906-76054928 CTGTCCTCACACAGTCTGGGAGG + Intronic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1124487140 15:30128504-30128526 CTGGCCTTACAGTGTCTGGGTGG + Intergenic
1124542226 15:30597479-30597501 CTGGCCTTACAGTGTCTGGGTGG + Intergenic
1124548931 15:30659584-30659606 CTGTCCTTATAGTGTCTGGGTGG + Intronic
1124632174 15:31344239-31344261 CCCTCCTGACACAGGCTGGAGGG - Intronic
1124756385 15:32409819-32409841 CTGGCCTTACAGTGTCTGGGTGG - Intergenic
1127389267 15:58492091-58492113 CCCTGCTGTCAGATTCTGGGTGG - Intronic
1128251618 15:66167843-66167865 CCGGCCTCACAAAGTCTGAGAGG - Intronic
1129159200 15:73737808-73737830 CCCTCCGGACAGACGCTGGGGGG + Exonic
1129191441 15:73939983-73940005 CTCTCCTGACAGAGCCTGAGGGG + Intronic
1135837836 16:25843421-25843443 CCTTCCTGACCTAGTCTTGGAGG + Intronic
1136278048 16:29191177-29191199 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1136482860 16:30553469-30553491 CCCTCCTGGCAGGGTCTAGGAGG + Intronic
1136621976 16:31435701-31435723 CCGTCCTGAGCGGGTCTGTGTGG + Exonic
1139188784 16:64837799-64837821 CCATCCTGCCAGTGTCGGGGTGG + Intergenic
1141568005 16:84916261-84916283 CCGGCCTGTCCGGGTCTGGGTGG + Intronic
1141995830 16:87635890-87635912 CCCTCCTGAGAGGGTCTGGAAGG + Intronic
1142082424 16:88157217-88157239 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1143294922 17:5863771-5863793 CCGTCTTGTCAGTGTCTTGGAGG + Intronic
1145993952 17:29095109-29095131 ACCTCCTGACAGTGTCTGTGTGG - Intronic
1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG + Exonic
1146955183 17:36933194-36933216 GCGGCCTCACCGAGTCTGGGCGG + Intergenic
1147185242 17:38709802-38709824 CCTGCCTGTCAGAGTCTAGGAGG + Intronic
1148970399 17:51475750-51475772 CCATCCTGACTCAGTCTGGAAGG - Intergenic
1151463907 17:74272446-74272468 GGGTCCTGACAGGGGCTGGGTGG - Intergenic
1151545159 17:74788392-74788414 CTGTCCTTCCAGAGGCTGGGGGG + Intronic
1152476862 17:80524047-80524069 CTGTGCTGGCAGCGTCTGGGAGG + Intergenic
1157236111 18:45966966-45966988 GGGTCCTGACAGAGTGTGGCAGG + Intronic
1161057640 19:2198593-2198615 CCATCCTGAGAGACGCTGGGTGG + Intronic
1161785052 19:6319362-6319384 CCCGCCTGGCAGAGCCTGGGTGG - Intronic
1162348920 19:10137276-10137298 ATGTCCTGAAAGAGTGTGGGGGG + Exonic
1162448839 19:10742156-10742178 CCCTCCTGCCAGAGACTTGGGGG + Intronic
1163406556 19:17126497-17126519 CCATTCTGACAGAGACTGGGTGG - Intronic
1163512914 19:17746825-17746847 CTGCCCTGACTGAGCCTGGGAGG + Intergenic
1163523524 19:17806559-17806581 CCCTTGTGACAGATTCTGGGAGG + Intronic
1168152353 19:54455912-54455934 CTGTCCTGCCAGTGTCTGGCGGG + Intronic
925715025 2:6775946-6775968 GTGTCCTGTCAGAGTGTGGGGGG - Intergenic
927207618 2:20619952-20619974 GGGTCATGACAGAGTCTTGGTGG - Intronic
927492497 2:23529798-23529820 CCGTCCTGAGACAGCCTGGGGGG + Intronic
928466519 2:31527747-31527769 CCCTCCTCACAGAGTCTAGGAGG + Intronic
928601525 2:32908554-32908576 CGGTCTTTCCAGAGTCTGGGAGG + Intergenic
936947250 2:117941804-117941826 CCCTACTGACCGGGTCTGGGAGG + Intronic
937446236 2:121960880-121960902 CCATCCTGACTGTGTCTGGAGGG + Intergenic
937447453 2:121970934-121970956 CCGTCCTGACTGTGGGTGGGTGG + Intergenic
937885249 2:126895078-126895100 CCTGGCTGTCAGAGTCTGGGTGG - Intergenic
942222791 2:173787893-173787915 CAGTCTGGAGAGAGTCTGGGTGG - Intergenic
942467594 2:176224899-176224921 CAGTACTGACAGACCCTGGGTGG + Intergenic
947640071 2:231702248-231702270 AAGGCATGACAGAGTCTGGGAGG - Intergenic
947838974 2:233195391-233195413 CCGTCTTCACAAAGTCTGGAAGG - Exonic
1171449549 20:25226009-25226031 CCTTCCTGCAAGAGTCTGGGAGG + Exonic
1175734280 20:61374407-61374429 GAGTCCTGAGAGGGTCTGGGAGG + Intronic
1176048598 20:63105040-63105062 CCGTCCACACAGAGAGTGGGCGG - Intergenic
1176145722 20:63564578-63564600 ACGTCCTGGCAGAGGCTGGCCGG + Exonic
1178885227 21:36479634-36479656 CCGTCCTGGAAGCGTCTGGTTGG - Exonic
1182405942 22:30130544-30130566 CTGTCCTGAAAGTGTGTGGGGGG - Intronic
1183312004 22:37115245-37115267 CCGTCTAGACAGCGTCTGGCTGG - Intergenic
1184152422 22:42646663-42646685 CGGTCCTGCCAGAATCTGAGCGG + Intronic
1185077591 22:48691639-48691661 CAGTCCTGCCATAATCTGGGAGG + Intronic
961532209 3:127546834-127546856 CCGTGGAGACAGAGACTGGGAGG + Intergenic
961645917 3:128392744-128392766 CCCACCTGAGAGAGTGTGGGGGG + Intronic
961955257 3:130794857-130794879 CTGTGCTGACAGAGTCTATGTGG + Intergenic
968405649 4:337299-337321 CCGTCCTCACAGAGCCTAGTTGG - Intergenic
974725246 4:65790283-65790305 CCATCCTGAAAGAGTTTGGTGGG - Intergenic
978937663 4:114397908-114397930 GGCTCCTGACAGAGTCTGGCTGG + Intergenic
980807456 4:137831821-137831843 CCTTCCTGGCAGAGTCTGCCAGG + Intergenic
990484822 5:56247835-56247857 CCTTCCTGGCAGACTCTGGAGGG + Intergenic
997485509 5:134226961-134226983 CTGTCCTGACCGCGTCTCGGTGG + Intergenic
997850711 5:137330225-137330247 CCATCCCCACAGTGTCTGGGGGG - Intronic
999101368 5:149028504-149028526 CAGGCCTGGCAGAGCCTGGGAGG - Exonic
1002310947 5:178313439-178313461 CCGTCCTGATGGAGACTGTGGGG + Intronic
1013304825 6:108838418-108838440 CGGCCCTGTGAGAGTCTGGGCGG + Intergenic
1017481878 6:154865472-154865494 CAGTCTTGACAGAGTTTGGAAGG + Intronic
1017590604 6:155974657-155974679 CCGTACTGCCAGATGCTGGGAGG + Intergenic
1022199012 7:28097757-28097779 CAGGCCTGCTAGAGTCTGGGAGG + Intronic
1022769125 7:33450022-33450044 CCGACCTGACAGGGAGTGGGAGG - Intronic
1024700389 7:51899787-51899809 CCGCCCTGCCTGGGTCTGGGAGG - Intergenic
1029375733 7:100176061-100176083 CCCTGGAGACAGAGTCTGGGGGG + Intronic
1030280694 7:107771542-107771564 CTGTCCTGCCAGAGTCAGGGAGG + Intronic
1031646425 7:124231336-124231358 AAGTCCTGACACAGTCTCGGTGG - Intergenic
1031941880 7:127797865-127797887 AAGTCCTGACAGGGTCTTGGGGG + Intronic
1038344413 8:26718908-26718930 CCCACCTGCCAGAGTCTGGAAGG - Intergenic
1041020338 8:53632386-53632408 CTGTCCTGATAGAGTCATGGGGG - Intergenic
1044741595 8:95332794-95332816 CCCTCCAGACACATTCTGGGTGG - Intergenic
1048197784 8:132346752-132346774 CCTGCAGGACAGAGTCTGGGAGG + Intronic
1049511012 8:143026684-143026706 CCGTGCAGACAGAGCCTGGGAGG + Intergenic
1049997470 9:1046200-1046222 CCGTCCGCGCAGAGTCCGGGCGG + Intergenic
1057422331 9:94922319-94922341 ACGTCCTTACAGAGACTGGAGGG - Intronic
1060530600 9:124345224-124345246 TCGACCAGTCAGAGTCTGGGTGG + Intronic
1191719715 X:64219369-64219391 CCTGCCTCACACAGTCTGGGTGG - Intergenic
1195343227 X:103925019-103925041 CTGTCCTGAGAGTGTCTGGAAGG + Intronic
1197636971 X:128926215-128926237 GAGGCCTGACAGAGTGTGGGGGG - Intergenic
1198256045 X:134925428-134925450 TTGTCCTGACAGCCTCTGGGAGG - Intergenic
1200702222 Y:6412031-6412053 TCATCCCGACAAAGTCTGGGAGG + Intergenic
1201031889 Y:9752667-9752689 TCATCCCGACAAAGTCTGGGAGG - Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic