ID: 1146893135

View in Genome Browser
Species Human (GRCh38)
Location 17:36521500-36521522
Sequence CTCCTTCTGGAACTTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146893135_1146893140 -10 Left 1146893135 17:36521500-36521522 CCTCACAGAAGTTCCAGAAGGAG 0: 1
1: 0
2: 4
3: 32
4: 288
Right 1146893140 17:36521513-36521535 CCAGAAGGAGAAAACAGGGGAGG 0: 1
1: 0
2: 4
3: 44
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146893135 Original CRISPR CTCCTTCTGGAACTTCTGTG AGG (reversed) Intronic
901152154 1:7110991-7111013 CTCCTTCTGGAAGCTCTGGGAGG + Intronic
902277466 1:15350049-15350071 CTGTTTCTGGAAGTTCTGTGGGG - Intronic
904034130 1:27550027-27550049 CTCCTTCAGTGACTTCTTTGAGG - Exonic
904644805 1:31957713-31957735 CTCCTTCCTGAGCTTCTGTGAGG + Intergenic
905009793 1:34739531-34739553 CTCTTTCTGGATCTTCCTTGCGG + Intronic
905065963 1:35183145-35183167 CTCCTTGTGCTACTTCTGTTGGG - Exonic
905719700 1:40186672-40186694 CTCATTCTGAAAGCTCTGTGAGG + Intronic
905948271 1:41922023-41922045 CTCCATCTGGAACTCCTATTAGG - Intronic
906742640 1:48197525-48197547 CTCTTTCCTTAACTTCTGTGTGG - Intergenic
907133744 1:52119942-52119964 CTACTTAGGGAACTTCTGGGGGG - Intergenic
908163256 1:61432511-61432533 CTGCTCCTTGAACTTCTGTGTGG - Intronic
908890733 1:68844638-68844660 CTGCTTCTGGGGCTTCTGTGGGG - Intergenic
912236415 1:107855987-107856009 CTGCCTCTGCAGCTTCTGTGAGG - Intronic
914845515 1:151281741-151281763 CCCATTCTGTAACTTCTGTACGG + Exonic
916418445 1:164614017-164614039 CTTCCTCTGGTATTTCTGTGGGG + Intronic
917950721 1:180031473-180031495 ATCTTTCTGGACATTCTGTGAGG + Exonic
918612971 1:186513095-186513117 CCCCTTCAGGATCTGCTGTGGGG + Intergenic
919742766 1:200990705-200990727 CTTCTTCTGGAACTTCTTTCTGG + Exonic
920155498 1:203946952-203946974 CTCCTTCTGGAGCTCCACTGAGG + Intergenic
920251523 1:204625251-204625273 CCCCTTCTGGAATTGCTGGGAGG + Intronic
920647750 1:207815763-207815785 CTCCTTCTGGCTTTTCTGTGTGG - Intergenic
921446969 1:215258396-215258418 CCCCTTCAAGAAATTCTGTGAGG - Intergenic
921462247 1:215443391-215443413 TTCCTTCAGGAACTCCTGTAAGG + Intergenic
922663790 1:227452052-227452074 GTCCTTCTAGCAATTCTGTGAGG - Intergenic
924820460 1:247484940-247484962 CTCCATGTGGGATTTCTGTGCGG - Intergenic
1063245348 10:4212330-4212352 TTCCTTCAGGATCATCTGTGGGG - Intergenic
1063426336 10:5952960-5952982 ATCCTGCTGGGACTTCTGAGAGG + Exonic
1065078097 10:22101282-22101304 CCCATTCAGGAACTCCTGTGGGG - Intergenic
1065739323 10:28782779-28782801 CTGCTTCTTGAAATTCTTTGAGG + Intergenic
1067292691 10:44955931-44955953 GTCTTGCAGGAACTTCTGTGTGG + Intergenic
1067448087 10:46365146-46365168 CTCCTTCTGGAAAGTATATGGGG - Intergenic
1067589293 10:47495615-47495637 CTCCTTCTGGAAACTATATGGGG + Intergenic
1067636418 10:48003697-48003719 CTCCTTCTGGAAACTATATGGGG + Intergenic
1067897766 10:50202400-50202422 CTACTTCTGGATATACTGTGAGG + Intronic
1068556158 10:58461702-58461724 ATCCCTCTGGAACATCTTTGAGG + Intergenic
1072040774 10:91604078-91604100 CCCATTCTCCAACTTCTGTGCGG - Intergenic
1073061237 10:100735133-100735155 GCCCTTCTGGAACCACTGTGTGG + Intergenic
1073598673 10:104824851-104824873 TTTCTTCTGGAGCTTCTGTCAGG - Intronic
1073687337 10:105769756-105769778 CTCCTACTGGATTTTCTGTCGGG - Intergenic
1074217910 10:111405777-111405799 CTTGTTCTGGAAATTCTGTGAGG + Intergenic
1074910288 10:117902466-117902488 TTCCCCCTGGAACCTCTGTGGGG + Intergenic
1075715407 10:124552425-124552447 CTCCATGTGGATCTGCTGTGGGG - Intronic
1076130134 10:128008328-128008350 CTCCTCCTGGAGCTTCTGGAAGG + Intronic
1076221644 10:128738552-128738574 TTCCACTTGGAACTTCTGTGGGG + Intergenic
1079629756 11:22659564-22659586 TTCCTTCTCATACTTCTGTGAGG + Intronic
1081210543 11:40328536-40328558 CTCTTTCTGGGACTTCTCTAAGG + Intronic
1082856191 11:57809326-57809348 CTCCTCTTGGAATTTCTCTGAGG + Exonic
1084179536 11:67439495-67439517 CTCCTTCAGGAAGATCTGTGTGG + Intronic
1086307537 11:85497906-85497928 TTCCTTCAGGAGCTCCTGTGAGG - Intronic
1087066440 11:94032112-94032134 CAACCTGTGGAACTTCTGTGGGG - Intronic
1087078009 11:94143535-94143557 ATCCTCCTGGGAATTCTGTGAGG + Intronic
1087811132 11:102610065-102610087 GTCCTTCTAGAAATTCTGAGGGG + Intronic
1088788752 11:113205550-113205572 CCCCTCCCGGAACTCCTGTGGGG - Exonic
1089314311 11:117580752-117580774 TTCCTTCTAGCACTGCTGTGTGG + Intronic
1090745217 11:129699843-129699865 CTCCTTCTGCCACTTCTGAGTGG + Intergenic
1091162041 11:133432636-133432658 CTTCTTCTGGAACTTCAATTAGG + Intronic
1091716019 12:2776679-2776701 CTCCTTCCAGGACTGCTGTGAGG + Intergenic
1092054440 12:5497237-5497259 CCTCTTCTGGAACTTCTGAATGG + Intronic
1092865128 12:12753669-12753691 TTCTTTCTGGAACTTTTTTGAGG - Intronic
1093393280 12:18649885-18649907 CTCCTTCTTAGTCTTCTGTGTGG + Intergenic
1093896447 12:24579970-24579992 CTCCATCTGAAACTTCTCTAGGG - Intergenic
1095195268 12:39307582-39307604 CTGCTTCTGGAAATGCTGTCAGG - Exonic
1095363275 12:41370664-41370686 CTTCTTCTGGAACTTCTTTTAGG + Intronic
1095403587 12:41842676-41842698 TTCCTTCTGGAAGCTCTGAGGGG - Intergenic
1096644932 12:53027556-53027578 CTCCTTCTGGAAATTCATTATGG + Intronic
1096831526 12:54318172-54318194 CTCTTTCTGTTACTTCTTTGGGG + Intronic
1097544031 12:60976239-60976261 CTCCTTCAGGAGCTTTTGTAGGG + Intergenic
1097663376 12:62454550-62454572 ATCCTCCTGGATCTTTTGTGAGG - Intergenic
1098958565 12:76714038-76714060 TTCCTTCTGGAAGTTCTATCTGG + Intergenic
1100787344 12:98092369-98092391 CTCCTTCTGGAGGTTCTAGGGGG - Intergenic
1101798854 12:108003035-108003057 GTCCTTCTGGAAGTTCTATAAGG - Intergenic
1108810786 13:54220874-54220896 CTCCTTCAGGAGCTCTTGTGAGG - Intergenic
1112631289 13:101163867-101163889 CTCCTTCTGGAGGTTCTGAGGGG + Intronic
1113552782 13:111206029-111206051 CTCTTTCTTGGATTTCTGTGTGG + Intronic
1113762682 13:112860624-112860646 CTGCATTTGGAACATCTGTGTGG + Intronic
1114393620 14:22337039-22337061 CTCCTTCAGGAAGATCTCTGTGG + Intergenic
1114396740 14:22370525-22370547 CTCCTTCAGGAACTTTCTTGGGG - Intergenic
1115083898 14:29490402-29490424 ATCCCTGTTGAACTTCTGTGGGG + Intergenic
1116503492 14:45649843-45649865 CTCCTTCTGGATCTTCAGCGGGG + Intergenic
1118953940 14:70462330-70462352 GTCCTCATGGAACTTCTCTGTGG + Intergenic
1120072598 14:80120815-80120837 CTCCTTCTAGAAGTTCAGAGTGG + Intergenic
1120576368 14:86186345-86186367 CTCATTCTGGAATTTGTATGAGG - Intergenic
1121012543 14:90529312-90529334 CTCTGCCTGGAACCTCTGTGTGG - Exonic
1121813296 14:96910447-96910469 CTCCTTCAGGAACTGCTTTAGGG - Intronic
1121827058 14:97018963-97018985 TTCCTTCTGGAAGTTCTAGGGGG - Intergenic
1121847251 14:97183656-97183678 CACCATCTGGAACTTCTGGTGGG - Intergenic
1122556435 14:102583246-102583268 TTCCTGCTGGAACTTCACTGTGG - Intergenic
1122588197 14:102825755-102825777 GTTCTTCTGGAACTTCTGTGGGG + Intronic
1123506811 15:20949792-20949814 ATTCTTCTGGAAATTCTTTGAGG + Intergenic
1124041889 15:26113312-26113334 GTCATTCTGGGACTTCTTTGGGG + Intergenic
1124133974 15:27017694-27017716 TTCCTACGGGGACTTCTGTGTGG + Intronic
1126297124 15:47152597-47152619 CCCCTTCAGGATCTTCTGTATGG + Intergenic
1126321958 15:47434741-47434763 CTCCTTCTGAATCATATGTGAGG + Intronic
1127308478 15:57730453-57730475 CTCCTTCTGGAGGCTCTGAGGGG - Intronic
1128260082 15:66227265-66227287 TTCCTCCTGGAGCTGCTGTGAGG + Intronic
1129771859 15:78207891-78207913 CTCCTTCCCGCAGTTCTGTGTGG + Intronic
1129969008 15:79760815-79760837 CTCTTTCAGGAACTCCTCTGGGG + Intergenic
1131544100 15:93301367-93301389 CTTCTTCTGGGACTTCTTAGTGG + Intergenic
1202972397 15_KI270727v1_random:250632-250654 ATTCTTCTGGAAATTCTTTGAGG + Intergenic
1133035369 16:3031136-3031158 CTCCTGCTGGAGCCGCTGTGGGG + Exonic
1134088850 16:11378927-11378949 TTCCTTCTTGATCTTCTGTCTGG + Intronic
1135122477 16:19778322-19778344 CTCCCTGTGGGCCTTCTGTGGGG + Intronic
1140378705 16:74466908-74466930 TTCCTTCTGGAACTCGTGTTAGG - Intronic
1143100790 17:4503650-4503672 ATCCTTCCCCAACTTCTGTGGGG + Intronic
1144729431 17:17518077-17518099 CTCCCTCTGGGTCTTCTGAGGGG - Intronic
1146725251 17:35150766-35150788 CTCCATCTGGAATTTTTTTGGGG - Intronic
1146893135 17:36521500-36521522 CTCCTTCTGGAACTTCTGTGAGG - Intronic
1147445814 17:40474722-40474744 CTCCATCTGGAACTGCACTGGGG + Intergenic
1148015495 17:44519128-44519150 CTGCTTCTAGAATTTCTATGAGG + Intergenic
1148393539 17:47290671-47290693 CCCCTTTTGCAACATCTGTGAGG + Intronic
1148473301 17:47909620-47909642 ATCCTTCTAGGATTTCTGTGAGG - Intronic
1148497330 17:48060620-48060642 CCTCTTCTGGGACTGCTGTGAGG + Exonic
1148849457 17:50547748-50547770 CACCTGCTGGGACTCCTGTGGGG - Exonic
1150612376 17:66743981-66744003 CTCCTTGTAGAATTGCTGTGTGG + Intronic
1151507927 17:74541620-74541642 CTGCTTCTAGAGCTTCTCTGAGG + Exonic
1151513903 17:74579997-74580019 CTCCTTCAAGACCTTCTTTGTGG + Exonic
1151551521 17:74825109-74825131 GTCCTTCTGGGACCTCTGAGAGG - Intronic
1151681186 17:75623773-75623795 CTCCTGCTGGCACAGCTGTGGGG - Intergenic
1152326460 17:79642712-79642734 CTCCTTCTCGGCCTTCTTTGTGG - Intergenic
1155057499 18:22197794-22197816 CTCCTTCTCATACTCCTGTGTGG + Intronic
1155540482 18:26863815-26863837 CACCTTGTGGAGCTTCTCTGGGG + Intronic
1155566261 18:27138021-27138043 CTCCTTCTAGCACTTCTATCTGG + Intronic
1156229560 18:35140300-35140322 CTGCTTCCGGCTCTTCTGTGTGG - Exonic
1156650155 18:39216226-39216248 CTCCTTCTAATACTTCAGTGTGG + Intergenic
1157559743 18:48637890-48637912 CTCCTTCTGGGTTTTATGTGAGG - Intronic
1157608053 18:48938692-48938714 CTCCATCTGGAGTTTCTGTCTGG - Intronic
1160032808 18:75277713-75277735 CTCCTTCTGCCATTACTGTGGGG + Intronic
1160927722 19:1555111-1555133 CCTCCTCTGGAACGTCTGTGCGG + Exonic
1161237761 19:3206254-3206276 CTCCTGCTGGATCTGCTGTAGGG - Exonic
1161294603 19:3513305-3513327 CTCCTGCTGGAACCACTCTGCGG + Intronic
1165206524 19:34193061-34193083 CTCTATTTGGAACTTCTGTATGG + Intronic
1165975606 19:39673643-39673665 TTCCTGCTGGACCATCTGTGAGG - Intergenic
1166512212 19:43416473-43416495 CTCCTACAGTAACTACTGTGAGG + Exonic
924977938 2:195127-195149 CTCCTGCAGGAACTGCAGTGAGG - Intergenic
926551846 2:14310532-14310554 CTGCTCCTGGAGCTTCTGTGTGG - Intergenic
927067208 2:19485193-19485215 GTACTTGTGGAACTTCTATGTGG - Intergenic
927235358 2:20868606-20868628 CTCCTTCTGAAGGTTCTGAGAGG + Intergenic
927378450 2:22447720-22447742 CTTCTTATGGAACTTCTATCAGG - Intergenic
927417446 2:22893578-22893600 TTTCTTCTGGAAATCCTGTGAGG - Intergenic
928414251 2:31078650-31078672 CTGATTCTGGTACTTCTGTAGGG - Intronic
929303429 2:40332401-40332423 CTCTTTCTGCAACATGTGTGTGG + Intronic
930670596 2:54146404-54146426 CTTCTTTTAGAACTTCTGTATGG + Intronic
931838610 2:66126398-66126420 CTCCTTTTGGCACTGCTATGGGG - Intergenic
932239162 2:70143515-70143537 GTACTTCTGGAACTGCTGAGTGG + Intergenic
933647442 2:84824021-84824043 CTTCTTCCGGAACCTCTGTTCGG + Exonic
934777847 2:96950306-96950328 CTCCTTCTGGGCCTTGGGTGGGG + Intronic
935293583 2:101629447-101629469 CTTCTTTCAGAACTTCTGTGGGG + Intergenic
936786936 2:116104814-116104836 CTCTTTCTGAAACTTCTGTATGG + Intergenic
936900318 2:117474516-117474538 TTCCTTCAGGAACTCCCGTGAGG - Intergenic
937052332 2:118902552-118902574 CTCCCTATGGCACTTCTGAGAGG - Intergenic
937222457 2:120349628-120349650 CTACTACGGGAACTACTGTGAGG + Exonic
937743958 2:125388864-125388886 CTGTTTCAGGAACTTCTGTGAGG + Intergenic
938331219 2:130449855-130449877 CTTCTTCGGAAACCTCTGTGAGG + Intergenic
938358733 2:130671648-130671670 CTTCTTCGGAAACCTCTGTGAGG - Intergenic
939443796 2:142282929-142282951 TTACTTCTGTAACTCCTGTGAGG + Intergenic
943605723 2:189975145-189975167 TTCCTTCAGGAACTTTTGTAGGG + Intronic
946479535 2:220040803-220040825 CTCCTTCTGGGTCTCCTGTGGGG + Intergenic
947576964 2:231283226-231283248 CTCCTTCTGGAACTCCTATTGGG - Intronic
948554899 2:238802217-238802239 CTCTTTCTAGAACTTCTATGAGG - Intergenic
948897246 2:240933216-240933238 CTCCTGCTGGAGCTTCTGTGCGG - Intronic
1169204271 20:3731486-3731508 AAGCATCTGGAACTTCTGTGGGG + Intergenic
1170950235 20:20930277-20930299 CTCCTTCTCCAGCTTCTCTGCGG + Intergenic
1171558704 20:26100681-26100703 TTATTTCTGGAACTTCTGTTTGG - Intergenic
1171935061 20:31267196-31267218 TTCCTTCAGGAGCTCCTGTGAGG + Intergenic
1172301393 20:33852923-33852945 CTTTTTCTAGAAGTTCTGTGTGG - Intronic
1175352771 20:58337210-58337232 GTCCTTCTGGAAGTTCTGAGGGG + Intronic
1175555599 20:59853350-59853372 CCACTTCTGTAAATTCTGTGTGG - Intergenic
1176131227 20:63497629-63497651 CTCCTTCTCGAACTTCTCAATGG + Exonic
1177945656 21:27466424-27466446 CCCCTTCTGGACTTGCTGTGAGG + Intergenic
1178083917 21:29093912-29093934 CTCCTTCTAGGATTACTGTGGGG + Intronic
1178779077 21:35582254-35582276 TTCTTTTTGGTACTTCTGTGGGG + Intronic
1178946810 21:36955105-36955127 GTCCTTCAGGAGCTACTGTGGGG + Intronic
1180211471 21:46297531-46297553 CTCCTTCTGGAACATCTGGAAGG - Exonic
1181168118 22:20994096-20994118 CTCCTGCTCCAGCTTCTGTGGGG - Exonic
1181482018 22:23206053-23206075 CTCCTCCGGCAACTTCTCTGAGG - Intronic
1183390180 22:37541268-37541290 CTCCTTCTGCCACTTCTGAATGG - Intergenic
1184406709 22:44304633-44304655 CTCCTTCTGGCCCTCCTGGGAGG + Intronic
1185068308 22:48642941-48642963 CTCCTTCTGGGACTACTGACAGG - Intronic
1185283952 22:49991328-49991350 CTCCTTTCGGGACTCCTGTGAGG - Intergenic
949892782 3:8745696-8745718 CTCCTTCTGCCACATCTGGGCGG + Exonic
950724893 3:14910853-14910875 TTCCTTCAGAAACTCCTGTGGGG - Exonic
950978947 3:17280876-17280898 CTCCTTCTGGGGCTTCAGGGTGG + Intronic
951537787 3:23755357-23755379 CTACTTCTGGAACTGTTATGAGG - Intergenic
952611721 3:35217183-35217205 CTCCTTCTGGAGTTTCTGCCTGG - Intergenic
952621387 3:35347310-35347332 TTCCTTCAGGAAGTTCTGAGGGG + Intergenic
953338116 3:42111140-42111162 CTCCTTCTGGACCTTCTGTCTGG - Intronic
953885985 3:46714586-46714608 CCCCTCCTGGATCTTCTGGGAGG - Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
955839630 3:63097715-63097737 CTCCTACTGGAATTTCTGCCTGG - Intergenic
957475038 3:80711402-80711424 TTCCTTCTGGAGCTCTTGTGAGG - Intergenic
957707872 3:83813483-83813505 CCCCTTCAGGATCTGCTGTGGGG + Intergenic
960033512 3:113079440-113079462 CTCCTAAAGGAACTTCTGTGAGG - Intergenic
960733394 3:120750570-120750592 ATGCTGCTGGAACTTCAGTGAGG - Exonic
961813019 3:129532561-129532583 CTCCTTCTCTGCCTTCTGTGTGG - Exonic
962267644 3:133955096-133955118 CTCCTTCTGGGGGTTCTGGGTGG + Exonic
962735730 3:138323569-138323591 ATCCTTCTGGAACCTCTGTGTGG - Intronic
962740173 3:138357555-138357577 CTCCTTGTAGAAATTCTCTGAGG + Intronic
964628338 3:158781028-158781050 CTCCTTATCAAACTTCTATGGGG + Intronic
964644847 3:158948052-158948074 CTCCTTCTCCAAATTCTGTGGGG - Intergenic
964821362 3:160773890-160773912 CTCCTTCTGTGACTTCTCTGTGG + Intronic
965605601 3:170495385-170495407 CTCCTTCTGGAATCTCTGCCTGG + Intronic
966861248 3:184231903-184231925 CTCCTTCTGGAACATTCCTGGGG - Intronic
967433122 3:189411739-189411761 CTCTTTCTGAAACTTCTTGGTGG + Intergenic
968550124 4:1217961-1217983 TTCGTTCTGGAATTTCTATGTGG - Intronic
968880769 4:3298261-3298283 CTCTTTCTGGAACTTTTATTTGG + Intronic
969078734 4:4601735-4601757 TTCCTTCTACAACTTCTCTGGGG - Intergenic
969264216 4:6054611-6054633 CTTCTTCTGCAAGCTCTGTGGGG - Intronic
971780764 4:31031446-31031468 GTCCTTTGGGAAATTCTGTGTGG + Intronic
974513655 4:62878693-62878715 TTCCTTCTGGATCTTCTGAAGGG + Intergenic
975433969 4:74329541-74329563 TTCCTTCTGGAACTCATGTTGGG - Intergenic
977666447 4:99650935-99650957 CTCCTCCTTGAGCTTCTCTGGGG + Exonic
978477061 4:109143073-109143095 CTCCTTCAGGAACTCTTGTAAGG + Intronic
978720834 4:111907075-111907097 CTCCTTCTGGGACTTCAGAAAGG - Intergenic
981098094 4:140802383-140802405 GTCCCTCTGGAAATTCTATGTGG + Intergenic
981128306 4:141132223-141132245 CTCCTTCTGGGAAGTCCGTGCGG - Intronic
981436523 4:144729881-144729903 CTCATTCTGAAATTTTTGTGAGG - Intronic
982097901 4:151939929-151939951 CTCCTTCCAGAAATGCTGTGGGG - Intergenic
982898934 4:160972961-160972983 TTCTTTCTGGATTTTCTGTGTGG - Intergenic
982921306 4:161277512-161277534 CTCCTCCTTGGACTCCTGTGAGG + Intergenic
985656806 5:1136162-1136184 CTCCTGCAGGCACTGCTGTGCGG + Intergenic
987382919 5:17302565-17302587 CTGCATGTAGAACTTCTGTGTGG + Intergenic
987445657 5:18016020-18016042 TTCTTTCTGGTACTTTTGTGCGG + Intergenic
988884821 5:35545258-35545280 CTCCTTCTGGAGCCTCTGAGGGG + Intergenic
990900653 5:60745002-60745024 CTCCTTCTGGAATCTCTGCCTGG - Intergenic
990908879 5:60833774-60833796 CACCTTCTAGGGCTTCTGTGAGG + Intronic
992941779 5:81769651-81769673 CTCCTTCTAGATCTTCACTGAGG - Intergenic
994164686 5:96596391-96596413 TTCCTTCTGGAGGTTCTGAGGGG - Intronic
994434069 5:99706307-99706329 CCCCTTCTGGGGCTTCGGTGTGG + Intergenic
995308470 5:110682898-110682920 CTCCCTCTCAGACTTCTGTGTGG + Intronic
995786700 5:115838677-115838699 CTCTTTCTGCAACTTCTTTTTGG - Intronic
996100968 5:119445445-119445467 CTCCTTTGGGGACTTCTTTGAGG - Intergenic
997209283 5:132068065-132068087 CTCTTTCTGGAAAATCTGTATGG + Intergenic
997375989 5:133398056-133398078 CTCTGTCGGGAACCTCTGTGGGG - Intronic
997552637 5:134766909-134766931 CTACTTCTGGAACGTCTGAAAGG - Exonic
998135622 5:139672913-139672935 GTCCTTCTGGGGCTCCTGTGTGG - Intronic
1001837874 5:174847253-174847275 CTCCTTCTCGACCATCTGTGGGG + Intergenic
1001902320 5:175442799-175442821 GTCCTTCTGTAACATCTGGGTGG - Exonic
1002169346 5:177366700-177366722 CTTCTTCAGGAACTCCTGGGAGG - Exonic
1002553269 5:180014192-180014214 CTACTTCTGGAAATTATGTAGGG - Intronic
1006550868 6:34822115-34822137 CTTATTCTGGAACTGCTGTATGG + Intronic
1008292812 6:49738627-49738649 CTTCCTCTGGGAGTTCTGTGGGG - Intronic
1008420019 6:51287814-51287836 TTCCTTCTGGAACTTCTTATTGG + Intergenic
1008922881 6:56861555-56861577 ATCCATCTGGAACAACTGTGTGG + Intronic
1009727662 6:67556523-67556545 CTCCTTCTGGAGCTCTTGTACGG + Intergenic
1011237581 6:85234313-85234335 CTCCTTCTGTAACATCAGAGAGG - Intergenic
1011425058 6:87218977-87218999 TTCCTTCTGTAACTTCTGACAGG + Intronic
1012442241 6:99271302-99271324 ACCCTTCTAGAACTTGTGTGGGG - Exonic
1015184649 6:130400893-130400915 CTGCTTCTGTAACAACTGTGTGG - Intronic
1015418080 6:132973141-132973163 CTTCTTCTGCATCTTTTGTGAGG - Intergenic
1015539406 6:134298730-134298752 CTCCTTCTGGAATCTCTGCCTGG - Intronic
1016755191 6:147677299-147677321 CTCATTCAGGAACTTCAGAGTGG - Intronic
1018317102 6:162568323-162568345 CTCCTTCTGGAATCTCTGCCTGG + Intronic
1019440826 7:1045679-1045701 CTCCTTCAAGAACTACTGTAAGG + Intronic
1020022848 7:4879312-4879334 CTCCCTCCAGAACCTCTGTGGGG + Intronic
1021063564 7:16144292-16144314 CTGCTTCAGGAACTTCAGTTGGG - Intronic
1023158281 7:37273644-37273666 CTCCTCCTGGAAATTGGGTGTGG - Intronic
1023380645 7:39604185-39604207 CTTCCTCTGGATGTTCTGTGTGG - Intronic
1024130458 7:46346946-46346968 TTCCTTCTGGTAGTCCTGTGTGG + Intergenic
1024566879 7:50688724-50688746 CACCTTCTGGCCATTCTGTGTGG - Intronic
1024797532 7:53036457-53036479 CGCCATCTGGGACTTCTGGGAGG + Exonic
1026803683 7:73416157-73416179 CTCTTTCTGGAATTTCTATTAGG - Intergenic
1027534361 7:79378338-79378360 ATCCTTGTAAAACTTCTGTGAGG + Intronic
1028420602 7:90628478-90628500 GTCCTTCTCAAACTTCAGTGTGG + Intronic
1028579598 7:92394170-92394192 ATCCTTCTAGAACTTCCATGGGG - Intronic
1029275399 7:99400974-99400996 CTTCTTCTGGAACTTCTGCAGGG - Intronic
1031276240 7:119727224-119727246 CCCCCTGAGGAACTTCTGTGGGG - Intergenic
1033583081 7:142754033-142754055 CTCCTCCTGGCAATTCTGAGAGG + Intronic
1033586102 7:142775505-142775527 CTCCTTCTGGCAATTCTGAGAGG + Intergenic
1034724644 7:153324254-153324276 CTCCTGCTGCCACTTCTCTGAGG - Intergenic
1034844962 7:154436091-154436113 CTTCTTCTGGAACTTATTTGAGG + Intronic
1035470848 7:159107682-159107704 CTGCTTCTGGAACTGCTGCAGGG + Intronic
1035851477 8:2923281-2923303 CTCCTTCTGTAAGTTTTCTGTGG - Intergenic
1037269059 8:17105428-17105450 CTATTTCTAGAACTTCTGTTTGG - Exonic
1038537954 8:28368107-28368129 CTCCTTCTGGAACTGTCATGTGG - Intronic
1039493258 8:37963672-37963694 GTCCTTCTGACACTGCTGTGAGG + Exonic
1040129471 8:43777910-43777932 CTCTTTCTGGAAAATCTGTGAGG + Intergenic
1040130284 8:43787758-43787780 CTCTTTTTGGAAAATCTGTGGGG + Intergenic
1041985586 8:63918867-63918889 CTTCTTCTGGAATTTCCATGAGG - Intergenic
1042294514 8:67204805-67204827 TTTGTTCTGGAAATTCTGTGAGG + Exonic
1042574755 8:70205625-70205647 CTCCTTCTGGGTCTTCTGTTTGG - Intronic
1042740668 8:72041305-72041327 TTCCTTATTGAACTTCTGTCTGG - Intronic
1044127907 8:88481164-88481186 TTCTTTCTGGAACTCTTGTGAGG - Intergenic
1045802308 8:106116130-106116152 TTCCTTCAGGAACTTTTGTAGGG + Intergenic
1046004662 8:108464450-108464472 CTCCTCCTGGCAATTCTGGGTGG + Intronic
1046772941 8:118135031-118135053 CTCCTCCAGTCACTTCTGTGTGG - Intergenic
1048322795 8:133413857-133413879 CTCCTGGTGAAACTGCTGTGTGG - Intergenic
1048833228 8:138496394-138496416 CTCCATCTGGGACTCCTGGGGGG + Intronic
1049172564 8:141170818-141170840 CTCCTTCTGTCACTCCTCTGTGG + Intronic
1049327708 8:142032216-142032238 CTCCCACTCGAACCTCTGTGTGG - Intergenic
1051784655 9:20729223-20729245 TTCCTTCTGGAGGCTCTGTGGGG + Intronic
1051880671 9:21836674-21836696 CTCCATCTGGAATTGCTTTGGGG + Intronic
1052901848 9:33800169-33800191 CTCCTCCTGGCAATTCTGAGAGG + Intergenic
1053252959 9:36590363-36590385 TTCCTTCTGGAGGTTCTGAGAGG + Intronic
1054766829 9:69049032-69049054 CTCCTTCTGGCAGTTCTGGGAGG + Intronic
1055210509 9:73784978-73785000 TTCCTTCAGGAACTTTTGTAAGG - Intergenic
1056426167 9:86479360-86479382 CTCCTTCAGGAACTCTTGTAAGG + Intergenic
1056728543 9:89143537-89143559 CACCTTCTGAAACTCCTGGGTGG - Intronic
1057487875 9:95500166-95500188 CATCTTCTGGAACCTCTGAGCGG + Intronic
1057549932 9:96044960-96044982 CTCATTCTGGAACTAGAGTGAGG + Intergenic
1059346278 9:113631190-113631212 CTCCTTCTGGATCATCTGGAGGG - Intergenic
1062068628 9:134542833-134542855 CTCCTTCTGGAATTTGTTTTGGG + Intergenic
1186491615 X:9977954-9977976 CTCCTTCTGTCTCTCCTGTGTGG - Intergenic
1187134717 X:16536034-16536056 CTTCTTCTGGAACTTCTCCTGGG + Intergenic
1187203291 X:17156875-17156897 ATCTTTCTGGAAGTTCTGAGAGG + Intergenic
1187259293 X:17670416-17670438 CTTCTTCTGTCAGTTCTGTGAGG - Intronic
1189201912 X:39203718-39203740 CTCCTTCTGGGACTTCAGAAGGG + Intergenic
1189301528 X:39955950-39955972 CTTCTCCTGCATCTTCTGTGTGG + Intergenic
1189791668 X:44610942-44610964 CTGTTACAGGAACTTCTGTGAGG - Intergenic
1190836260 X:54103485-54103507 ATCCATCTGGAATTTATGTGAGG + Intronic
1191154203 X:57253745-57253767 TTCCTTCAGGAGCTCCTGTGAGG - Intergenic
1191222557 X:58004722-58004744 TTCCTTCAGGAACTCCTGTAAGG - Intergenic
1191635957 X:63377014-63377036 TTCCTTCTGGAGCTCCTGTAAGG - Intergenic
1191636150 X:63379455-63379477 TTCCTCCTGGAACTTTTGAGTGG + Intergenic
1192200423 X:69063016-69063038 CTCCTGCTGAACCTTCAGTGGGG + Intergenic
1192216405 X:69162367-69162389 CTCCACCTGGAAGTACTGTGTGG + Exonic
1192702982 X:73496199-73496221 CTCCTTCAGGAGCTTTTGTAAGG + Intergenic
1193571868 X:83153641-83153663 CTCCTTCTGGAGCTCTTGTAAGG - Intergenic
1193897466 X:87130567-87130589 TTCCTTCAGGAGCTTTTGTGAGG - Intergenic
1195770569 X:108346926-108346948 ATTCTTCTGGAACTGCTGGGTGG - Intronic
1195961722 X:110393999-110394021 ATTCTTCTGGAACTGCTGGGTGG + Intronic
1198295189 X:135280652-135280674 TTCCTTCAGGAACTCTTGTGAGG + Intronic
1199927085 X:152479521-152479543 CTCCTTCTGGAATCTCTGCCTGG + Intergenic
1200072112 X:153534359-153534381 CTCCTTCTGGGGGTGCTGTGTGG - Intronic
1200173451 X:154096369-154096391 CTCATTCTGGAATTGCTCTGTGG - Intronic
1200228538 X:154432570-154432592 CACCTTCTGGAAGGGCTGTGAGG - Intronic