ID: 1146898586

View in Genome Browser
Species Human (GRCh38)
Location 17:36564965-36564987
Sequence CATTCTCTAAGATAAACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146898586_1146898587 -2 Left 1146898586 17:36564965-36564987 CCTGTAGTTTATCTTAGAGAATG 0: 1
1: 0
2: 2
3: 15
4: 135
Right 1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG 0: 1
1: 0
2: 1
3: 9
4: 111
1146898586_1146898588 -1 Left 1146898586 17:36564965-36564987 CCTGTAGTTTATCTTAGAGAATG 0: 1
1: 0
2: 2
3: 15
4: 135
Right 1146898588 17:36564987-36565009 GTTATGTAAGATCACCTAAAGGG 0: 1
1: 0
2: 0
3: 3
4: 98
1146898586_1146898590 23 Left 1146898586 17:36564965-36564987 CCTGTAGTTTATCTTAGAGAATG 0: 1
1: 0
2: 2
3: 15
4: 135
Right 1146898590 17:36565011-36565033 AAGAGAGTAAAAGAATTCTGAGG 0: 1
1: 2
2: 7
3: 74
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146898586 Original CRISPR CATTCTCTAAGATAAACTAC AGG (reversed) Intronic
900846571 1:5108031-5108053 CATTACCCAAGATAATCTACTGG - Intergenic
909011144 1:70336866-70336888 CATTCTATAACATCAACTATAGG - Intronic
909406194 1:75292087-75292109 GATTTTCTATGATGAACTACAGG + Intronic
910497747 1:87851900-87851922 CAATCTCTACGTTAATCTACTGG - Intergenic
912108100 1:106306239-106306261 CAATGTCTAAGATAAAACACTGG + Intergenic
917168606 1:172143898-172143920 CCTTCTGTAATATAAACAACAGG - Intronic
920840505 1:209549928-209549950 CTTACTCAAAGATAAACTCCTGG + Intergenic
922070226 1:222184874-222184896 CAATCTCTAGGATAAACTCAAGG - Intergenic
923942968 1:238849660-238849682 CATTTTCTAAGCTAAGCTTCAGG - Intergenic
924929662 1:248718150-248718172 CATTCTCCAGGATAGACCACAGG + Intergenic
1063934536 10:11063982-11064004 CATTCACTCAGTTGAACTACAGG + Intronic
1065247236 10:23770623-23770645 CACTCTCTCAGAAAAACCACTGG - Intronic
1066320071 10:34294076-34294098 CTTTCTCTAGGACAAACAACAGG + Intronic
1067969233 10:50950604-50950626 CATTCTCTAAGATTTATAACAGG + Intergenic
1067994029 10:51249161-51249183 CATTCTCTACAAAAAACTAGGGG + Intronic
1068487625 10:57680001-57680023 GTTTCTCTAAGATAAAATATTGG + Intergenic
1068860146 10:61839673-61839695 CATACTCTAAGAAAACGTACAGG - Intergenic
1069065432 10:63937367-63937389 CAATCTCTAAGGTAAACCCCTGG - Intergenic
1070663386 10:78325698-78325720 CATTCTCTAGGATAGACCATAGG - Intergenic
1071286134 10:84147456-84147478 CAACCTCTAATATAAAGTACAGG - Intronic
1075418567 10:122283869-122283891 AATTCTCAAAGAAAAACTTCTGG - Exonic
1075925714 10:126250314-126250336 TGCTCTCTAAGATAAACCACTGG + Intronic
1077985595 11:7348156-7348178 CATTCTCCTAGAAAAACTACAGG + Intronic
1079743727 11:24098839-24098861 CAATCACTAATATAAACTATTGG - Intergenic
1081265553 11:41016611-41016633 CATCCTCTAGGATTCACTACTGG - Intronic
1081441738 11:43088366-43088388 CATTCTCCAAGAGAAAATTCAGG - Intergenic
1086315461 11:85587118-85587140 CATTCTCCAAGATAGACCATAGG - Intronic
1088032638 11:105269828-105269850 CTTTCTCTCAGCTAAACTCCTGG + Intergenic
1097557109 12:61152286-61152308 TATTCTCTAAGATATATTAAAGG + Intergenic
1101654354 12:106706890-106706912 CATTCAGTTAGATAAACTAATGG + Intronic
1103456657 12:121072389-121072411 GATTCTCTAGGATAAACCACTGG - Intergenic
1104098021 12:125578019-125578041 CATTCTCTAGGACATACCACAGG - Intronic
1109009664 13:56924239-56924261 TATTATCTAAAATATACTACAGG - Intergenic
1109905884 13:68840951-68840973 CATTCTCCAAGATAGACTACAGG + Intergenic
1113954777 13:114092580-114092602 CATTCTCCAGGATAGACTATAGG - Intronic
1114879970 14:26772498-26772520 CATTATATAAGAAAAACCACAGG + Intergenic
1115505099 14:34086233-34086255 TATTTTCTAAAATAAAATACAGG + Intronic
1115994136 14:39177761-39177783 CATTTTCTAAGAAATACTACAGG - Intronic
1117335089 14:54750273-54750295 CAGTCTCTAAGATGAAACACTGG - Intronic
1117696219 14:58366920-58366942 ATTTCTCCAAGAAAAACTACAGG + Exonic
1120619996 14:86751451-86751473 CATTCTCAAGGATAAAATATAGG - Intergenic
1122535868 14:102462194-102462216 CTGCCTCTAAGAGAAACTACAGG - Intronic
1123223402 14:106877604-106877626 TATTCTCTAACTTAGACTACGGG - Intergenic
1125099325 15:35891898-35891920 TATTTTCTAAGATAAACTAGAGG - Intergenic
1125182453 15:36893071-36893093 GATTTTCAGAGATAAACTACCGG - Intronic
1127534114 15:59874087-59874109 CACTCTCTAACGTAAACTCCAGG + Intergenic
1131570894 15:93535082-93535104 CATTCTCTAAGATCATTTCCAGG - Intergenic
1138684348 16:58711632-58711654 CATTTTTCAAGAGAAACTACAGG - Intronic
1140577572 16:76189013-76189035 CATATTCTAAGATTGACTACAGG + Intergenic
1144125615 17:12199880-12199902 CAGTCTCTAAGACAAACTGGGGG - Intergenic
1144261488 17:13526284-13526306 AATTCTCTAAGATACAATGCAGG - Intronic
1146754632 17:35418150-35418172 CACTCTCAAAGAAAAACTAAAGG + Intronic
1146898586 17:36564965-36564987 CATTCTCTAAGATAAACTACAGG - Intronic
1150870172 17:68899677-68899699 CATTCTCCAAGATGAGCTAAAGG + Intronic
1156881106 18:42080709-42080731 CACTCTCTGGGATAAGCTACAGG + Intronic
1158881681 18:61784851-61784873 CATCCTTCAAGATAAACTGCAGG - Intergenic
1168039345 19:53745648-53745670 CATTCTCCAGGATAGACCACAGG - Intergenic
1168040860 19:53757501-53757523 CATTCTCCAGGATAGACCACAGG - Intergenic
1168041252 19:53760711-53760733 CATTCTCTAGGATAGACCACAGG - Intergenic
926565045 2:14459633-14459655 CATTCTCTAAGTCAAAAGACAGG - Intergenic
927356634 2:22181155-22181177 TATCCTTTAAGATAAAGTACAGG - Intergenic
929251535 2:39761925-39761947 CATTGTCTAAAATAATTTACTGG + Intronic
930497953 2:52173112-52173134 CATTCTCTAAAATATAATATGGG - Intergenic
930841486 2:55852064-55852086 CATTCTCTAACAGAATATACAGG - Intergenic
931806957 2:65816819-65816841 CATTCTGTAAGATCAGCTTCTGG + Intergenic
933037818 2:77422441-77422463 CATACTTTAAGATACTCTACTGG + Intronic
933787351 2:85854092-85854114 CTTTCTCTATGAAAAATTACAGG + Intronic
933863233 2:86491254-86491276 CAATCACGAAGATAAATTACAGG + Exonic
936737208 2:115460587-115460609 AATTTTCTAAGAAAATCTACAGG - Intronic
937332746 2:121042498-121042520 CCTTGTCTCAGATAAACTAGTGG + Intergenic
937727460 2:125184688-125184710 CATTCTCAAAGCAAAACCACAGG + Intergenic
942741718 2:179188151-179188173 CATACTCTAAGACCAACCACAGG + Intronic
943625461 2:190194162-190194184 CATTCACCAAGATAGACTATTGG - Intronic
945049503 2:205809603-205809625 AATTCTCAAGGATAAACTACTGG + Intergenic
946255984 2:218442224-218442246 CATTCTCCAAGATAGAAAACTGG + Intronic
947567871 2:231206609-231206631 CATTCTGTAAAACAAACTACAGG - Intronic
948480817 2:238249374-238249396 CATTTTCATAGAAAAACTACGGG - Intronic
1169587601 20:7103715-7103737 TATACTCTATGATAAACAACAGG + Intergenic
1170297417 20:14843566-14843588 CATTCTCTCAAATATGCTACAGG + Intronic
1175080999 20:56420152-56420174 CATTCACTAACATAAACTCGTGG - Intronic
1178689279 21:34737876-34737898 CATGCTTTTAAATAAACTACTGG - Intergenic
952027107 3:29096718-29096740 CATTCTTTAAGATAGACCATAGG - Intergenic
954190490 3:48956622-48956644 CCTTCTGTAAGAGACACTACTGG - Intronic
954319585 3:49822599-49822621 CCATCTCTAAGAAAAAATACAGG - Intergenic
956388951 3:68751237-68751259 CTCTCTTTAAGATAAACTCCAGG - Intronic
957225899 3:77445837-77445859 CTTTCTGTAATATAAACCACAGG + Intronic
964672562 3:159242731-159242753 CATTTTCTAAGAGAAAATATAGG + Intronic
966005785 3:175010185-175010207 CATTCCCTCAGATAAACTAAGGG + Intronic
971254679 4:25003613-25003635 CATTCTCTCAGATATACCAGTGG - Exonic
972018920 4:34283281-34283303 CATTCTCAAAAATAAATTCCAGG + Intergenic
972704652 4:41530431-41530453 TAATCTATAAGATAAACCACTGG - Intronic
974370305 4:61008226-61008248 CATTGTATAAAATAAACTATAGG - Intergenic
975200949 4:71588854-71588876 CATTCTCAAACAAAAACTATAGG - Intergenic
977339272 4:95737528-95737550 CATTATGTGAGATAAACTAAAGG + Intergenic
977527571 4:98163687-98163709 CATACTATAAGATAAACAATGGG - Intergenic
978935989 4:114376732-114376754 CATTCTTTAAAATAAAATACTGG + Intergenic
981366043 4:143904536-143904558 CATTTTCTAAGATACCCTAGGGG - Intronic
981376158 4:144018345-144018367 CATTTTCTAAGATACCCTAGGGG - Intronic
981386672 4:144139689-144139711 CATTTTCTAAGATACCCTAGGGG - Intronic
983872407 4:172837203-172837225 AATTCTTTATGATGAACTACTGG - Intronic
984501307 4:180562966-180562988 CATTCTCAAACATATAATACCGG + Intergenic
984714456 4:182913698-182913720 CATTCTCAGACATAAAATACAGG + Intronic
985014663 4:185621035-185621057 AATTCTATAACATAGACTACTGG - Intronic
985711079 5:1430336-1430358 CATGCTCTAAGAAAAACGCCGGG + Intronic
985963476 5:3321653-3321675 CATTCTCTAAGTAAAGCTAGTGG - Intergenic
986257537 5:6112940-6112962 TATTCTCTAAAATAAATCACGGG + Intergenic
987499234 5:18685582-18685604 CATTCTCTAAGCTGAACTATTGG - Intergenic
989971179 5:50526522-50526544 TATTCTCTCAGATAAAATGCAGG + Intergenic
990858461 5:60299015-60299037 CATACTTTAATATTAACTACTGG + Intronic
996913663 5:128684811-128684833 CATCTTCAAAGAAAAACTACAGG + Intronic
997493550 5:134300495-134300517 CATGCTCTAAAATAAACTACAGG + Intronic
999086338 5:148894126-148894148 CATTCTCCAAGATAGACCATAGG + Intergenic
1000366515 5:160496243-160496265 CATTATCTAAGAAAAAGAACTGG - Intergenic
1000383785 5:160654336-160654358 CATAATCTAAGAAAAACTACAGG - Intronic
1003754333 6:9099786-9099808 CTTTCTCTATGAAAAACTAAAGG + Intergenic
1013628921 6:111966022-111966044 CATTCTGCAAAATAAACAACTGG + Intergenic
1013703016 6:112796634-112796656 CATTCTCTAAAATAATCAGCTGG - Intergenic
1014867419 6:126549906-126549928 CATTTTCTGAGATAAGCTACTGG - Intergenic
1015219584 6:130788920-130788942 TATTGTCTAAGATAATCTTCTGG - Intergenic
1017408367 6:154143531-154143553 CCTTCTCTTGCATAAACTACTGG + Intronic
1021567998 7:22033134-22033156 CATTTTCCAAGAGAAACAACTGG + Intergenic
1022946152 7:35286479-35286501 CATTATCTAAGATGAGCTAGTGG - Intergenic
1023187939 7:37550629-37550651 CAGTCACTGAGATAGACTACAGG + Intergenic
1025794571 7:64727067-64727089 CTTTCTCCAAGATAAACCACAGG - Intergenic
1025925363 7:65955075-65955097 CATTCTGTAAGGTTAACAACTGG - Exonic
1027718909 7:81712929-81712951 CCTCCTCTAGGATAAGCTACAGG - Intronic
1028439246 7:90839707-90839729 CTTTCTCTAGTATAAACTATTGG + Intronic
1030640336 7:111997979-111998001 CATTCTCTAAAATAGAATAATGG + Intronic
1030823176 7:114120873-114120895 CAGGCTCTAAGACAAACCACTGG - Intronic
1031090682 7:117349987-117350009 GGTTCTCTAAGGTAAACTACTGG - Intergenic
1033477986 7:141709151-141709173 CACTCTATCAGCTAAACTACAGG - Intronic
1036499322 8:9298761-9298783 CATTCTCTCCCATTAACTACTGG + Intergenic
1037723256 8:21462679-21462701 CATTCCCTAAGATGAATCACAGG + Intergenic
1041138791 8:54790477-54790499 ATTTCTCTAGGATCAACTACTGG - Intergenic
1044572703 8:93737393-93737415 CGTTGTTTAAGATAAATTACAGG - Intronic
1045363733 8:101456291-101456313 CATTCTCCAGGATAAACCATGGG + Intergenic
1045914467 8:107450220-107450242 CATTGTCATAGATAAACTATTGG + Intronic
1046277270 8:111980462-111980484 GATTCTCTTAGAAAGACTACAGG - Intergenic
1048694057 8:137004293-137004315 CATGGTATAAGAGAAACTACAGG + Intergenic
1050724275 9:8629190-8629212 CCTTCTCTAAGACAAAGTTCTGG - Intronic
1055157746 9:73085117-73085139 CCTTCTCAAGGATAAACCACAGG - Intergenic
1057318403 9:93988342-93988364 CATTCTCCAAGATAGACCATAGG + Intergenic
1058362764 9:104169706-104169728 CAATCACTAACATAAACTAAAGG + Intergenic
1058628828 9:106964752-106964774 TATTCTATAAGATAAAATATAGG - Intronic
1060325124 9:122607028-122607050 CTTTCCCTAAGAAAAGCTACAGG - Intergenic
1061153164 9:128840910-128840932 ATTTCTCTAAGATAAATTCCTGG - Intronic
1186013093 X:5159751-5159773 CTTTCTTTAAGATAAATTACTGG + Intergenic
1191162839 X:57351060-57351082 CATTCTCCAATATGAACCACAGG + Intronic
1191757793 X:64613134-64613156 GATCCTCCAAGATAATCTACGGG + Intergenic
1194214067 X:91107281-91107303 CATTCTCCAAGATAGACCATAGG - Intergenic
1194425841 X:93737232-93737254 CATACTCTAAGATTGACCACAGG - Intergenic
1195681470 X:107550090-107550112 CATTTTCTAAGAAAACCTTCAGG - Exonic
1199366379 X:146989403-146989425 TATTCTCAAGGATAAACCACAGG + Intergenic