ID: 1146898587

View in Genome Browser
Species Human (GRCh38)
Location 17:36564986-36565008
Sequence TGTTATGTAAGATCACCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146898586_1146898587 -2 Left 1146898586 17:36564965-36564987 CCTGTAGTTTATCTTAGAGAATG 0: 1
1: 0
2: 2
3: 15
4: 135
Right 1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG 0: 1
1: 0
2: 1
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146898587 Original CRISPR TGTTATGTAAGATCACCTAA AGG Intronic
904190474 1:28739073-28739095 TCTAATGTAAAATCACCTGAAGG + Intronic
906553175 1:46683655-46683677 TGTACTGTAAGATCTTCTAATGG - Intronic
906849716 1:49235307-49235329 TATTATTTAAGATTAACTAATGG + Intronic
911080091 1:93920197-93920219 TGTTATGTAAGATTGCCTGGAGG + Intergenic
916567994 1:165998508-165998530 TGTTTTGTAAGAAAACCTGATGG + Intergenic
919250339 1:195048152-195048174 TGATATGTAAAATCAAATAAAGG - Intergenic
921172628 1:212562763-212562785 TGTTATCTAAGATCAACATATGG + Intergenic
921711290 1:218376163-218376185 TATTGTGTAAGAACACTTAACGG - Intronic
924206509 1:241717044-241717066 CATGATGTAAGATCACCTATGGG + Intronic
1065828521 10:29594141-29594163 TGTTATGTAAAATAAACTTAAGG + Intronic
1066562272 10:36683054-36683076 TGTTCTATAAGATCATCTACAGG - Intergenic
1067992804 10:51234523-51234545 TGTTTGGTAAGAAAACCTAAAGG - Intronic
1068329327 10:55540643-55540665 TGTTATGTAATATCAATTAAAGG + Intronic
1069137886 10:64786356-64786378 TGTTATGTAACATCACATGTAGG + Intergenic
1081069458 11:38593394-38593416 GGTTATGTGAGATCAGATAAGGG - Intergenic
1081351317 11:42055980-42056002 TTTTATGTAAGATAAAATAAAGG - Intergenic
1081465332 11:43311722-43311744 TCATATGTAAGATCTTCTAAGGG + Intergenic
1083140360 11:60716455-60716477 TGTTATGTATGATAACCAATGGG + Intergenic
1083220124 11:61247036-61247058 TGTTATGCAAGAATACCTGAGGG + Intronic
1086898161 11:92337097-92337119 TGTTATCTAAGCTAACTTAAAGG - Intergenic
1087903651 11:103670796-103670818 TGTTATGAAAGCTCCCCTAGAGG + Intergenic
1091657831 12:2358735-2358757 TGTTCTGTGAGATCACCTCTTGG + Intronic
1094333042 12:29317303-29317325 TATTATGTAAGATTACCTTCAGG + Intronic
1098573082 12:72011122-72011144 AGTTATGTAAGTTCAGCAAAGGG + Intronic
1100085927 12:90910727-90910749 TGTAATGTGATATCACCTTATGG - Intronic
1106263161 13:28086316-28086338 AGTAATGTAACATCACCTAAAGG - Intronic
1106507528 13:30384293-30384315 TGTTATATAAGATGACATCATGG + Intergenic
1106564006 13:30870203-30870225 TGCTATGTGAGGTCATCTAAGGG + Intergenic
1108796809 13:54042230-54042252 TGTTATATAAGCTAACCTAGGGG - Intergenic
1111436688 13:88220100-88220122 GCTTATTTAAGATCACCTCATGG - Intergenic
1113302944 13:109042727-109042749 TGTTAAATAATATTACCTAAGGG - Intronic
1116106559 14:40514787-40514809 TCTTATTCAAGATCACCAAATGG + Intergenic
1117855648 14:60029366-60029388 TACTATATAAGATCACCTCATGG - Intronic
1118936258 14:70291480-70291502 TGAAATGTAAGATCATCTGAAGG + Intergenic
1120006823 14:79367540-79367562 TGTTCTGTAACATCACATCAGGG + Intronic
1120085993 14:80273996-80274018 TGTTATGTAGCATTACCTAAGGG - Intronic
1135508054 16:23056193-23056215 TCTTATGTAAGATGACCTGAAGG + Intergenic
1137458337 16:48635405-48635427 TGTCATGGAAGGCCACCTAAGGG - Intergenic
1139110798 16:63888191-63888213 GGTTATGTATGATAACCTATTGG + Intergenic
1140720400 16:77766340-77766362 TGTTATGTAACATCACGGCAAGG + Intergenic
1203105594 16_KI270728v1_random:1353662-1353684 TATAATGCAAAATCACCTAAAGG - Intergenic
1203127920 16_KI270728v1_random:1608706-1608728 TATAATGCAAAATCACCTAAAGG + Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1150187243 17:63196127-63196149 TGTAATGTAATATCAGTTAATGG - Intronic
1155085405 18:22453229-22453251 TATTATGTAACATCCCCTATTGG - Intergenic
1156145637 18:34174020-34174042 TCTTATGAAACATGACCTAATGG + Intronic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1160446461 18:78931516-78931538 TGTTATGTCAGATGAGCTAAAGG - Intergenic
1164214957 19:23136256-23136278 TGTAAAGTAAGATTACCAAAGGG - Intronic
1166012148 19:39950418-39950440 TGTTACCTAAGGTCACCTCAAGG + Intergenic
1168091371 19:54087304-54087326 TATTAAGTAAGACCACCAAATGG + Intergenic
926351319 2:11997629-11997651 TCTCATGTAAAATAACCTAATGG - Intergenic
928298939 2:30108952-30108974 CTTTATGTAAAAACACCTAAAGG + Intergenic
929401010 2:41581729-41581751 TGTGATCTAATATCACCTACAGG - Intergenic
930215944 2:48697484-48697506 TGTTTTGGAAGATCAGTTAATGG + Intronic
933391071 2:81667409-81667431 TGTTAGGCAATATCACGTAAGGG + Intergenic
937472260 2:122184274-122184296 GTTTATTTAAGGTCACCTAATGG - Intergenic
941725099 2:168852186-168852208 TGTGAGGGAAGATCACCCAAAGG + Intronic
943050835 2:182911083-182911105 TCTTAGGAAAGAACACCTAATGG - Intronic
945500911 2:210573686-210573708 GGTTATGTGAGATTACCAAATGG + Intronic
946017542 2:216615977-216615999 TGTTCTTTAAGACCACCTGATGG - Intergenic
1171332644 20:24354748-24354770 TATTATGTTAGATCAGATAACGG + Intergenic
1174664640 20:52246596-52246618 TGTGATGAAAAATCACCTAATGG - Intergenic
1175078554 20:56397341-56397363 TGCTATGTCACATCACATAAAGG + Exonic
1176696832 21:9988227-9988249 TCTTATGTAAGATTAACTTATGG + Intergenic
951826177 3:26871574-26871596 TGTTCTGTAAGAGAACCTAGAGG - Intergenic
957582680 3:82094795-82094817 TCTTATTTAAAATCACCTTATGG + Intergenic
959348450 3:105229487-105229509 TGTTTTGCAAGAGCAGCTAAGGG - Intergenic
961183446 3:124894624-124894646 TGTTTTCTCATATCACCTAAAGG + Intronic
962485734 3:135840552-135840574 TGTAACATAAGATCACATAATGG - Intergenic
964205891 3:154174698-154174720 TTTTATATTAGAGCACCTAAAGG + Intronic
965491752 3:169345810-169345832 CGTTATGTAAAATCACTTCAAGG - Intronic
967451971 3:189635353-189635375 TGTAAGTTAAAATCACCTAAAGG + Intronic
972149318 4:36068812-36068834 TTTTATGTATGTTCACCTTATGG + Intronic
973170062 4:47130911-47130933 TGCTTTTTAAGCTCACCTAATGG - Intronic
976286209 4:83373863-83373885 TCTTATGTAAGCTCAGCTATGGG + Intergenic
976636278 4:87289475-87289497 TTTTATTCAATATCACCTAATGG - Intergenic
980369432 4:131848414-131848436 TCTTATGTAAGATTAACTTATGG + Intergenic
980641091 4:135580920-135580942 TGTTATGAAAAATCAATTAAGGG + Intergenic
980900201 4:138897652-138897674 TGTTATTTAACTTCACCTAATGG + Intergenic
981648722 4:147030415-147030437 TAGTATGTTATATCACCTAAAGG + Intergenic
982488333 4:155996858-155996880 TGTTATCTAAAATCTCCTATGGG + Intergenic
986638338 5:9847268-9847290 TGTTATGTAAGATCAGGCATAGG - Intergenic
988028784 5:25735368-25735390 TTTTTTTTAAGATTACCTAAGGG - Intergenic
988294428 5:29336499-29336521 TGTTATAAAAGATCAGATAAAGG + Intergenic
988360853 5:30234772-30234794 TGTTATGAACTATAACCTAAAGG - Intergenic
989437684 5:41433955-41433977 TGTGACGTAATATCACCTGATGG + Intronic
990266774 5:54085103-54085125 TGTCATTTCAGTTCACCTAAAGG - Intronic
993010895 5:82481231-82481253 TTTTATCTATAATCACCTAAAGG - Intergenic
996239839 5:121183421-121183443 TATTATGTATGATGACATAATGG - Intergenic
1006764130 6:36489908-36489930 TGTTAAGTCAGATCATTTAATGG + Exonic
1012200557 6:96400941-96400963 AATTATGTAACATCACATAAAGG - Intergenic
1013020773 6:106215135-106215157 TTTTATGTAAGTACACCAAAAGG - Intronic
1016719702 6:147281615-147281637 TCTTATTTAAGTTCATCTAATGG + Intronic
1019827176 7:3294023-3294045 TGATAAGTGAAATCACCTAAGGG - Intergenic
1020768092 7:12351458-12351480 TTTTTAGAAAGATCACCTAAAGG - Intronic
1022609413 7:31854212-31854234 TGCTATCTAATATCACCTGAGGG - Intronic
1026670274 7:72384195-72384217 TTTTATGTAAGTCCACATAATGG - Intronic
1031425601 7:121601632-121601654 TGTTATGCAGGACCACTTAAAGG + Intergenic
1032315293 7:130832458-130832480 TGTTTTGTAAGTACACTTAAAGG + Intergenic
1038102506 8:24394208-24394230 TGTTAACTAAGATCTCCAAAGGG + Intronic
1039201645 8:35101039-35101061 TGTTATGAAGGATCAACGAATGG + Intergenic
1040892818 8:52335563-52335585 TATTGTGTAAGATCACCTTCAGG - Intronic
1047423305 8:124725011-124725033 TGTTGTGCAAAATCACCTACTGG - Intronic
1053389347 9:37723102-37723124 TGTAATGAAATATCACCAAAGGG - Intronic
1053633811 9:39974082-39974104 TCTTATGTAAGATTAACTTATGG + Intergenic
1053771936 9:41489418-41489440 TCTTATGTAAGATTAACTTATGG - Intergenic
1054210076 9:62276615-62276637 TCTTATGTAAGATTAACTTATGG - Intergenic
1054314918 9:63572311-63572333 TCTTATGTAAGATTAACTTATGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1058377928 9:104345810-104345832 TGTTATGTAACATAAACAAATGG - Intergenic
1186196846 X:7117465-7117487 TGTTCTGCTAGATAACCTAAAGG - Intronic
1186609553 X:11125673-11125695 TGTTATTTAAAATCATCAAATGG + Intergenic
1187820360 X:23281085-23281107 CGTTATTTAAGATAACCAAAAGG + Intergenic
1188126150 X:26372151-26372173 TGTTTTGTAAGAACAATTAAAGG + Intergenic
1189683292 X:43538329-43538351 TGTTATGTATGATCACAATAAGG + Intergenic
1189812207 X:44791132-44791154 TGTATTTTAAGATTACCTAACGG - Intergenic
1190437044 X:50435841-50435863 TGTCAGGTAAGGTCACCTCAGGG + Intronic
1190894408 X:54602608-54602630 TTTTATGTAATATAACCTAATGG - Intergenic
1193903873 X:87219016-87219038 TTAAATGTAAGATCAGCTAAAGG + Intergenic
1198296075 X:135288032-135288054 TGTTATCTCATATCACTTAATGG - Intronic
1199470183 X:148186702-148186724 TGTCATGTAAAATAACCTAGAGG + Intergenic