ID: 1146906164

View in Genome Browser
Species Human (GRCh38)
Location 17:36619376-36619398
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146906164_1146906173 16 Left 1146906164 17:36619376-36619398 CCCTGCCTTGGGCCAGGTGCAGT No data
Right 1146906173 17:36619415-36619437 CCTAGCACTTTGGAAGGCCAAGG 0: 287
1: 10415
2: 103588
3: 222124
4: 232290
1146906164_1146906169 6 Left 1146906164 17:36619376-36619398 CCCTGCCTTGGGCCAGGTGCAGT No data
Right 1146906169 17:36619405-36619427 TGCCTGTAATCCTAGCACTTTGG 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
1146906164_1146906175 23 Left 1146906164 17:36619376-36619398 CCCTGCCTTGGGCCAGGTGCAGT No data
Right 1146906175 17:36619422-36619444 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1146906164_1146906171 10 Left 1146906164 17:36619376-36619398 CCCTGCCTTGGGCCAGGTGCAGT No data
Right 1146906171 17:36619409-36619431 TGTAATCCTAGCACTTTGGAAGG 0: 913
1: 33227
2: 326044
3: 254571
4: 136488
1146906164_1146906174 19 Left 1146906164 17:36619376-36619398 CCCTGCCTTGGGCCAGGTGCAGT No data
Right 1146906174 17:36619418-36619440 AGCACTTTGGAAGGCCAAGGTGG 0: 1988
1: 60767
2: 149928
3: 159035
4: 96689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146906164 Original CRISPR ACTGCACCTGGCCCAAGGCA GGG (reversed) Intergenic
No off target data available for this crispr