ID: 1146906167

View in Genome Browser
Species Human (GRCh38)
Location 17:36619381-36619403
Sequence GAGCCACTGCACCTGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7264
Summary {0: 32, 1: 223, 2: 895, 3: 2118, 4: 3996}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146906167_1146906171 5 Left 1146906167 17:36619381-36619403 CCTTGGGCCAGGTGCAGTGGCTC 0: 32
1: 223
2: 895
3: 2118
4: 3996
Right 1146906171 17:36619409-36619431 TGTAATCCTAGCACTTTGGAAGG 0: 913
1: 33227
2: 326044
3: 254571
4: 136488
1146906167_1146906175 18 Left 1146906167 17:36619381-36619403 CCTTGGGCCAGGTGCAGTGGCTC 0: 32
1: 223
2: 895
3: 2118
4: 3996
Right 1146906175 17:36619422-36619444 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1146906167_1146906173 11 Left 1146906167 17:36619381-36619403 CCTTGGGCCAGGTGCAGTGGCTC 0: 32
1: 223
2: 895
3: 2118
4: 3996
Right 1146906173 17:36619415-36619437 CCTAGCACTTTGGAAGGCCAAGG 0: 287
1: 10415
2: 103588
3: 222124
4: 232290
1146906167_1146906174 14 Left 1146906167 17:36619381-36619403 CCTTGGGCCAGGTGCAGTGGCTC 0: 32
1: 223
2: 895
3: 2118
4: 3996
Right 1146906174 17:36619418-36619440 AGCACTTTGGAAGGCCAAGGTGG 0: 1988
1: 60767
2: 149928
3: 159035
4: 96689
1146906167_1146906169 1 Left 1146906167 17:36619381-36619403 CCTTGGGCCAGGTGCAGTGGCTC 0: 32
1: 223
2: 895
3: 2118
4: 3996
Right 1146906169 17:36619405-36619427 TGCCTGTAATCCTAGCACTTTGG 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
1146906167_1146906177 29 Left 1146906167 17:36619381-36619403 CCTTGGGCCAGGTGCAGTGGCTC 0: 32
1: 223
2: 895
3: 2118
4: 3996
Right 1146906177 17:36619433-36619455 CAAGGTGGATGGATAACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146906167 Original CRISPR GAGCCACTGCACCTGGCCCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr