ID: 1146906168

View in Genome Browser
Species Human (GRCh38)
Location 17:36619388-36619410
Sequence CAGGCATGAGCCACTGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378746
Summary {0: 6440, 1: 26478, 2: 70922, 3: 127775, 4: 147131}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146906168_1146906179 28 Left 1146906168 17:36619388-36619410 CCAGGTGCAGTGGCTCATGCCTG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
Right 1146906179 17:36619439-36619461 GGATGGATAACTTGAGGTCAGGG No data
1146906168_1146906175 11 Left 1146906168 17:36619388-36619410 CCAGGTGCAGTGGCTCATGCCTG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
Right 1146906175 17:36619422-36619444 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1146906168_1146906173 4 Left 1146906168 17:36619388-36619410 CCAGGTGCAGTGGCTCATGCCTG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
Right 1146906173 17:36619415-36619437 CCTAGCACTTTGGAAGGCCAAGG 0: 287
1: 10415
2: 103588
3: 222124
4: 232290
1146906168_1146906174 7 Left 1146906168 17:36619388-36619410 CCAGGTGCAGTGGCTCATGCCTG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
Right 1146906174 17:36619418-36619440 AGCACTTTGGAAGGCCAAGGTGG 0: 1988
1: 60767
2: 149928
3: 159035
4: 96689
1146906168_1146906169 -6 Left 1146906168 17:36619388-36619410 CCAGGTGCAGTGGCTCATGCCTG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
Right 1146906169 17:36619405-36619427 TGCCTGTAATCCTAGCACTTTGG 0: 7892
1: 107752
2: 241468
3: 240344
4: 208055
1146906168_1146906178 27 Left 1146906168 17:36619388-36619410 CCAGGTGCAGTGGCTCATGCCTG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
Right 1146906178 17:36619438-36619460 TGGATGGATAACTTGAGGTCAGG 0: 5
1: 485
2: 9270
3: 40639
4: 85218
1146906168_1146906171 -2 Left 1146906168 17:36619388-36619410 CCAGGTGCAGTGGCTCATGCCTG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
Right 1146906171 17:36619409-36619431 TGTAATCCTAGCACTTTGGAAGG 0: 913
1: 33227
2: 326044
3: 254571
4: 136488
1146906168_1146906177 22 Left 1146906168 17:36619388-36619410 CCAGGTGCAGTGGCTCATGCCTG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
Right 1146906177 17:36619433-36619455 CAAGGTGGATGGATAACTTGAGG No data
1146906168_1146906180 29 Left 1146906168 17:36619388-36619410 CCAGGTGCAGTGGCTCATGCCTG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
Right 1146906180 17:36619440-36619462 GATGGATAACTTGAGGTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146906168 Original CRISPR CAGGCATGAGCCACTGCACC TGG (reversed) Intergenic
Too many off-targets to display for this crispr